File Info

Filename
aih-tih-sc-d12f1f-R1_B23WHYVLT4_1.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/42/5d8c09862603464dae6a00d430cc56/aih-tih-sc-d12f1f-R1_B23WHYVLT4_1.fastp.log
Size
1.6 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44631539305(98.5244%)
Q30 bases: 43373785214(95.7479%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44491721072(98.2157%)
Q30 bases: 42930028210(94.7683%)

Read1 after filtering:
total reads: 295116469
total bases: 37981029106
Q20 bases: 37852338140(99.6612%)
Q30 bases: 37229154151(98.0204%)

Read2 after filtering:
total reads: 295116469
total bases: 38025489831
Q20 bases: 37804555616(99.419%)
Q30 bases: 37015397875(97.3436%)

Filtering result:
reads passed filter: 590232938
reads failed due to low quality: 9403468
reads failed due to too many N: 131890
reads failed due to too short: 231704
reads with adapter trimmed: 330823530
bases trimmed due to adapters: 13253848629

Duplication rate: 31.2468%

Insert size peak (evaluated by paired-end reads): 115

JSON report: aih-tih-sc-d12f1f-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-d12f1f-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-d12f1f-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-d12f1f-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-d12f1f-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-d12f1f-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-d12f1f-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-d12f1f-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 881 seconds