Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 278058675
total bases: 41986859925
Q20 bases: 41411421894(98.6295%)
Q30 bases: 40339602287(96.0767%)

Read2 before filtering:
total reads: 278058675
total bases: 41986859925
Q20 bases: 41189968401(98.102%)
Q30 bases: 39706618855(94.5692%)

Read1 after filtering:
total reads: 273512737
total bases: 36201612885
Q20 bases: 36084443895(99.6763%)
Q30 bases: 35500023912(98.062%)

Read2 after filtering:
total reads: 273512737
total bases: 36238161069
Q20 bases: 36005915514(99.3591%)
Q30 bases: 35190803011(97.1098%)

Filtering result:
reads passed filter: 547025474
reads failed due to low quality: 8718326
reads failed due to too many N: 122328
reads failed due to too short: 251222
reads with adapter trimmed: 270031943
bases trimmed due to adapters: 10267951635

Duplication rate: 32.8948%

Insert size peak (evaluated by paired-end reads): 118

JSON report: aih-tih-sc-79f487-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-79f487-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-79f487-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-79f487-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-79f487-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-79f487-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-79f487-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-79f487-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 808 seconds