Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44551927109(98.3486%)
Q30 bases: 43308584143(95.6039%)
Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44397042884(98.0067%)
Q30 bases: 42676737065(94.2091%)
Read1 after filtering:
total reads: 295151796
total bases: 37610129429
Q20 bases: 37490856965(99.6829%)
Q30 bases: 36889540637(98.0841%)
Read2 after filtering:
total reads: 295151796
total bases: 37662027624
Q20 bases: 37419492295(99.356%)
Q30 bases: 36564217837(97.0851%)
Filtering result:
reads passed filter: 590303592
reads failed due to low quality: 9309252
reads failed due to too many N: 126872
reads failed due to too short: 260284
reads with adapter trimmed: 355320344
bases trimmed due to adapters: 14007201870
Duplication rate: 35.2009%
Insert size peak (evaluated by paired-end reads): 118
JSON report: aih-tih-sc-7c6c07-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-7c6c07-R1_B23WHYVLT4_1.fastp.html
fastp --in1 aih-tih-sc-7c6c07-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-7c6c07-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-7c6c07-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-7c6c07-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-7c6c07-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-7c6c07-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 894 seconds