Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44584446968(98.4204%)
Q30 bases: 43262842985(95.503%)
Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44418270576(98.0536%)
Q30 bases: 42737652204(94.3436%)
Read1 after filtering:
total reads: 295357375
total bases: 38192774879
Q20 bases: 38064256360(99.6635%)
Q30 bases: 37413743842(97.9603%)
Read2 after filtering:
total reads: 295357375
total bases: 38239750710
Q20 bases: 37991398331(99.3505%)
Q30 bases: 37110105701(97.0459%)
Filtering result:
reads passed filter: 590714750
reads failed due to low quality: 8878246
reads failed due to too many N: 126212
reads failed due to too short: 280792
reads with adapter trimmed: 329395933
bases trimmed due to adapters: 12892166139
Duplication rate: 35.9433%
Insert size peak (evaluated by paired-end reads): 118
JSON report: aih-tih-sc-4dcd88-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-4dcd88-R1_B23WHYVLT4_1.fastp.html
fastp --in1 aih-tih-sc-4dcd88-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-4dcd88-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-4dcd88-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-4dcd88-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-4dcd88-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-4dcd88-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 689 seconds