Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44646935346(98.5584%)
Q30 bases: 43478624612(95.9793%)
Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44464124931(98.1548%)
Q30 bases: 42857315621(94.6078%)
Read1 after filtering:
total reads: 295193843
total bases: 38466501251
Q20 bases: 38338100219(99.6662%)
Q30 bases: 37709266385(98.0314%)
Read2 after filtering:
total reads: 295193843
total bases: 38508679018
Q20 bases: 38274423199(99.3917%)
Q30 bases: 37444727157(97.2371%)
Filtering result:
reads passed filter: 590387686
reads failed due to low quality: 9263548
reads failed due to too many N: 129648
reads failed due to too short: 219118
reads with adapter trimmed: 323348045
bases trimmed due to adapters: 12296068222
Duplication rate: 34.8595%
Insert size peak (evaluated by paired-end reads): 117
JSON report: aih-tih-sc-3e91d2-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-3e91d2-R1_B23WHYVLT4_1.fastp.html
fastp --in1 aih-tih-sc-3e91d2-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-3e91d2-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-3e91d2-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-3e91d2-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-3e91d2-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-3e91d2-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 869 seconds