File Info

Filename
aih-tih-sc-7fc50e-R1_B23WHYVLT4_1.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/76/314c3122f26d08f548fd108977fa83/aih-tih-sc-7fc50e-R1_B23WHYVLT4_1.fastp.log
Size
1.6 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 183885705
total bases: 27766741455
Q20 bases: 27227893219(98.0594%)
Q30 bases: 26316693577(94.7778%)

Read2 before filtering:
total reads: 183885705
total bases: 27766741455
Q20 bases: 27222384327(98.0395%)
Q30 bases: 26153881658(94.1914%)

Read1 after filtering:
total reads: 180961779
total bases: 22215423181
Q20 bases: 22140434078(99.6624%)
Q30 bases: 21778584954(98.0336%)

Read2 after filtering:
total reads: 180961779
total bases: 22251494225
Q20 bases: 22125450875(99.4336%)
Q30 bases: 21671440128(97.3932%)

Filtering result:
reads passed filter: 361923558
reads failed due to low quality: 5218816
reads failed due to too many N: 75390
reads failed due to too short: 553646
reads with adapter trimmed: 246904370
bases trimmed due to adapters: 10282790720

Duplication rate: 37.8361%

Insert size peak (evaluated by paired-end reads): 109

JSON report: aih-tih-sc-7fc50e-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-7fc50e-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-7fc50e-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-7fc50e-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-7fc50e-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-7fc50e-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-7fc50e-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-7fc50e-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 529 seconds