File Info

Filename
aih-tih-sc-f14fdc-R1_B23WHYVLT4_1.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/0f/2f6209bf5aebd13ad8654449e63ba3/aih-tih-sc-f14fdc-R1_B23WHYVLT4_1.fastp.log
Size
1.6 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44543939138(98.331%)
Q30 bases: 43208460186(95.3829%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44501485485(98.2373%)
Q30 bases: 42917300963(94.7402%)

Read1 after filtering:
total reads: 295326268
total bases: 37819346379
Q20 bases: 37674481420(99.617%)
Q30 bases: 36994506266(97.819%)

Read2 after filtering:
total reads: 295326268
total bases: 37866767677
Q20 bases: 37635632830(99.3896%)
Q30 bases: 36812175372(97.215%)

Filtering result:
reads passed filter: 590652536
reads failed due to low quality: 8883904
reads failed due to too many N: 128996
reads failed due to too short: 334564
reads with adapter trimmed: 344213047
bases trimmed due to adapters: 13636737713

Duplication rate: 34.3005%

Insert size peak (evaluated by paired-end reads): 115

JSON report: aih-tih-sc-f14fdc-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-f14fdc-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-f14fdc-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-f14fdc-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-f14fdc-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-f14fdc-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-f14fdc-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-f14fdc-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 836 seconds