Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 106143513
total bases: 16027670463
Q20 bases: 15625073013(97.4881%)
Q30 bases: 15010271002(93.6522%)

Read2 before filtering:
total reads: 106143513
total bases: 16027670463
Q20 bases: 15686000050(97.8682%)
Q30 bases: 15001812753(93.5995%)

Read1 after filtering:
total reads: 104241047
total bases: 11919721095
Q20 bases: 11875968934(99.6329%)
Q30 bases: 11667661432(97.8854%)

Read2 after filtering:
total reads: 104241047
total bases: 11947074193
Q20 bases: 11873278720(99.3823%)
Q30 bases: 11614911186(97.2197%)

Filtering result:
reads passed filter: 208482094
reads failed due to low quality: 3161808
reads failed due to too many N: 39772
reads failed due to too short: 603352
reads with adapter trimmed: 169318897
bases trimmed due to adapters: 7694120973

Duplication rate: 44.4979%

Insert size peak (evaluated by paired-end reads): 108

JSON report: aih-tih-sc-13a2f6-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-13a2f6-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-13a2f6-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-13a2f6-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-13a2f6-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-13a2f6-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-13a2f6-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-13a2f6-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 217 seconds