Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44432507478(98.085%)
Q30 bases: 42960424844(94.8354%)
Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44425978159(98.0706%)
Q30 bases: 42703200873(94.2676%)
Read1 after filtering:
total reads: 295556646
total bases: 36007937167
Q20 bases: 35881366255(99.6485%)
Q30 bases: 35270931618(97.9532%)
Read2 after filtering:
total reads: 295556646
total bases: 36065227152
Q20 bases: 35859259887(99.4289%)
Q30 bases: 35115550154(97.3668%)
Filtering result:
reads passed filter: 591113292
reads failed due to low quality: 8401482
reads failed due to too many N: 122476
reads failed due to too short: 362750
reads with adapter trimmed: 406292173
bases trimmed due to adapters: 17341185809
Duplication rate: 35.8543%
Insert size peak (evaluated by paired-end reads): 109
JSON report: aih-tih-sc-973c73-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-973c73-R1_B23WHYVLT4_1.fastp.html
fastp --in1 aih-tih-sc-973c73-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-973c73-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-973c73-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-973c73-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-973c73-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-973c73-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 801 seconds