Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 196387268
total bases: 29654477468
Q20 bases: 29137549181(98.2568%)
Q30 bases: 28099862646(94.7576%)

Read2 before filtering:
total reads: 196387268
total bases: 29654477468
Q20 bases: 29047261725(97.9524%)
Q30 bases: 27830402833(93.8489%)

Read1 after filtering:
total reads: 193153107
total bases: 22292268309
Q20 bases: 22211655467(99.6384%)
Q30 bases: 21830408102(97.9282%)

Read2 after filtering:
total reads: 193153107
total bases: 22338632570
Q20 bases: 22212393592(99.4349%)
Q30 bases: 21758540556(97.4032%)

Filtering result:
reads passed filter: 386306214
reads failed due to low quality: 5603390
reads failed due to too many N: 76252
reads failed due to too short: 788680
reads with adapter trimmed: 304539038
bases trimmed due to adapters: 13835617282

Duplication rate: 50.5718%

Insert size peak (evaluated by paired-end reads): 105

JSON report: aih-tih-sc-18a6f2-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-18a6f2-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-18a6f2-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-18a6f2-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-18a6f2-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-18a6f2-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-18a6f2-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-18a6f2-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 416 seconds