Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44663215185(98.5943%)
Q30 bases: 43271182717(95.5214%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44293433991(97.778%)
Q30 bases: 42464670735(93.741%)

Read1 after filtering:
total reads: 295050094
total bases: 36078929270
Q20 bases: 35947297871(99.6352%)
Q30 bases: 35317473049(97.8895%)

Read2 after filtering:
total reads: 295050094
total bases: 36137922179
Q20 bases: 35939854070(99.4519%)
Q30 bases: 35222232964(97.4661%)

Filtering result:
reads passed filter: 590100188
reads failed due to low quality: 9344706
reads failed due to too many N: 122812
reads failed due to too short: 432294
reads with adapter trimmed: 402000920
bases trimmed due to adapters: 17059078147

Duplication rate: 37.8657%

Insert size peak (evaluated by paired-end reads): 108

JSON report: aih-tih-sc-c7b68f-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-c7b68f-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-c7b68f-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-c7b68f-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-c7b68f-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-c7b68f-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-c7b68f-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-c7b68f-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 707 seconds