Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44188972274(97.5474%)
Q30 bases: 42554569537(93.9394%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44140749957(97.4409%)
Q30 bases: 42132410478(93.0075%)

Read1 after filtering:
total reads: 293566761
total bases: 34630594562
Q20 bases: 34500273704(99.6237%)
Q30 bases: 33881646914(97.8373%)

Read2 after filtering:
total reads: 293566761
total bases: 34712993783
Q20 bases: 34488274988(99.3526%)
Q30 bases: 33723207052(97.1487%)

Filtering result:
reads passed filter: 587133522
reads failed due to low quality: 11683568
reads failed due to too many N: 117104
reads failed due to too short: 1065806
reads with adapter trimmed: 449611531
bases trimmed due to adapters: 19564384423

Duplication rate: 47.693%

Insert size peak (evaluated by paired-end reads): 107

JSON report: aih-tih-sc-c5cb90-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-c5cb90-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-c5cb90-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-c5cb90-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-c5cb90-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-c5cb90-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-c5cb90-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-c5cb90-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 737 seconds