Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 291093060
total bases: 43955052060
Q20 bases: 43197997623(98.2777%)
Q30 bases: 41904874339(95.3357%)

Read2 before filtering:
total reads: 291093060
total bases: 43955052060
Q20 bases: 43042509982(97.9239%)
Q30 bases: 41312289402(93.9876%)

Read1 after filtering:
total reads: 286468145
total bases: 35769038473
Q20 bases: 35643407105(99.6488%)
Q30 bases: 35041927473(97.9672%)

Read2 after filtering:
total reads: 286468145
total bases: 35819881267
Q20 bases: 35609985671(99.414%)
Q30 bases: 34863711783(97.3306%)

Filtering result:
reads passed filter: 572936290
reads failed due to low quality: 8834168
reads failed due to too many N: 122544
reads failed due to too short: 293118
reads with adapter trimmed: 378322297
bases trimmed due to adapters: 15073418542

Duplication rate: 38.9701%

Insert size peak (evaluated by paired-end reads): 115

JSON report: aih-tih-sc-8b4971-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-8b4971-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-8b4971-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-8b4971-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-8b4971-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-8b4971-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-8b4971-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-8b4971-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 856 seconds