Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44837145105(98.9782%)
Q30 bases: 43832972469(96.7615%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44544872712(98.3331%)
Q30 bases: 43077881483(95.0947%)

Read1 after filtering:
total reads: 295416458
total bases: 40325587558
Q20 bases: 40200659236(99.6902%)
Q30 bases: 39571920831(98.131%)

Read2 after filtering:
total reads: 295416458
total bases: 40355722502
Q20 bases: 40107957122(99.386%)
Q30 bases: 39220923367(97.188%)

Filtering result:
reads passed filter: 590832916
reads failed due to low quality: 8863778
reads failed due to too many N: 133788
reads failed due to too short: 169518
reads with adapter trimmed: 245348443
bases trimmed due to adapters: 8619319743

Duplication rate: 38.3296%

Insert size peak (evaluated by paired-end reads): 130

JSON report: aih-tih-sc-b93682-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-b93682-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-b93682-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-b93682-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-b93682-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-b93682-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-b93682-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-b93682-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 705 seconds