Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44539607698(98.3214%)
Q30 bases: 43309598289(95.6062%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44430070564(98.0796%)
Q30 bases: 42827884086(94.5428%)

Read1 after filtering:
total reads: 294536503
total bases: 38102989522
Q20 bases: 37981292725(99.6806%)
Q30 bases: 37375233357(98.09%)

Read2 after filtering:
total reads: 294536503
total bases: 38152600907
Q20 bases: 37928575078(99.4128%)
Q30 bases: 37134231223(97.3308%)

Filtering result:
reads passed filter: 589073006
reads failed due to low quality: 10373706
reads failed due to too many N: 128732
reads failed due to too short: 424556
reads with adapter trimmed: 315893068
bases trimmed due to adapters: 12841118918

Duplication rate: 32.4892%

Insert size peak (evaluated by paired-end reads): 115

JSON report: aih-tih-sc-7c8bae-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-7c8bae-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-7c8bae-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-7c8bae-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-7c8bae-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-7c8bae-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-7c8bae-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-7c8bae-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 731 seconds