Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44502471230(98.2395%)
Q30 bases: 43114382113(95.1752%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44431529799(98.0828%)
Q30 bases: 42762742185(94.399%)

Read1 after filtering:
total reads: 295106750
total bases: 36319914634
Q20 bases: 36195351543(99.657%)
Q30 bases: 35602870197(98.0258%)

Read2 after filtering:
total reads: 295106750
total bases: 36376167116
Q20 bases: 36170987255(99.4359%)
Q30 bases: 35435272646(97.4134%)

Filtering result:
reads passed filter: 590213500
reads failed due to low quality: 8845166
reads failed due to too many N: 124228
reads failed due to too short: 817106
reads with adapter trimmed: 397469801
bases trimmed due to adapters: 16591695406

Duplication rate: 44.8029%

Insert size peak (evaluated by paired-end reads): 111

JSON report: aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 847 seconds