Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44542561629(98.328%)
Q30 bases: 43244655952(95.4628%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44502503614(98.2395%)
Q30 bases: 42919159407(94.7443%)

Read1 after filtering:
total reads: 295501023
total bases: 37793311860
Q20 bases: 37665909109(99.6629%)
Q30 bases: 37040378460(98.0078%)

Read2 after filtering:
total reads: 295501023
total bases: 37837415948
Q20 bases: 37619587715(99.4243%)
Q30 bases: 36827799082(97.3317%)

Filtering result:
reads passed filter: 591002046
reads failed due to low quality: 8636014
reads failed due to too many N: 126778
reads failed due to too short: 235162
reads with adapter trimmed: 340392184
bases trimmed due to adapters: 13739795521

Duplication rate: 39.4314%

Insert size peak (evaluated by paired-end reads): 115

JSON report: aih-tih-sc-6e7384-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-6e7384-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-6e7384-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-6e7384-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-6e7384-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-6e7384-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-6e7384-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-6e7384-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 755 seconds