Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 250357333
total bases: 37803957283
Q20 bases: 36697911190(97.0743%)
Q30 bases: 35134091178(92.9376%)

Read2 before filtering:
total reads: 250357333
total bases: 37803957283
Q20 bases: 36976330977(97.8107%)
Q30 bases: 35388212503(93.6098%)

Read1 after filtering:
total reads: 245985788
total bases: 27431534835
Q20 bases: 27335046039(99.6483%)
Q30 bases: 26874398756(97.969%)

Read2 after filtering:
total reads: 245985788
total bases: 27497798040
Q20 bases: 27351166751(99.4668%)
Q30 bases: 26823831235(97.549%)

Filtering result:
reads passed filter: 491971576
reads failed due to low quality: 7149020
reads failed due to too many N: 93556
reads failed due to too short: 1500514
reads with adapter trimmed: 409630901
bases trimmed due to adapters: 19551919237

Duplication rate: 45.5758%

Insert size peak (evaluated by paired-end reads): 98

JSON report: aih-tih-sc-a70f1e-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-a70f1e-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-a70f1e-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-a70f1e-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-a70f1e-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-a70f1e-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-a70f1e-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-a70f1e-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 517 seconds