Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44719356983(98.7182%)
Q30 bases: 43592951074(96.2317%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44461688885(98.1494%)
Q30 bases: 42898766833(94.6993%)

Read1 after filtering:
total reads: 294864597
total bases: 38926384398
Q20 bases: 38790353138(99.6505%)
Q30 bases: 38152552496(98.0121%)

Read2 after filtering:
total reads: 294864597
total bases: 38968045090
Q20 bases: 38731596220(99.3932%)
Q30 bases: 37901208754(97.2623%)

Filtering result:
reads passed filter: 589729194
reads failed due to low quality: 9821638
reads failed due to too many N: 133332
reads failed due to too short: 315836
reads with adapter trimmed: 306597440
bases trimmed due to adapters: 11276561132

Duplication rate: 44.2426%

Insert size peak (evaluated by paired-end reads): 119

JSON report: aih-tih-sc-445ab1-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-445ab1-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-445ab1-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-445ab1-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-445ab1-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-445ab1-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-445ab1-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-445ab1-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 861 seconds