Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 260891039
total bases: 39394546889
Q20 bases: 38616224609(98.0243%)
Q30 bases: 37287379476(94.6511%)

Read2 before filtering:
total reads: 260891039
total bases: 39394546889
Q20 bases: 38566318244(97.8976%)
Q30 bases: 36985111228(93.8838%)

Read1 after filtering:
total reads: 256257728
total bases: 31738729988
Q20 bases: 31598284452(99.5575%)
Q30 bases: 30985401729(97.6265%)

Read2 after filtering:
total reads: 256257728
total bases: 31791222398
Q20 bases: 31582885863(99.3447%)
Q30 bases: 30852326429(97.0467%)

Filtering result:
reads passed filter: 512515456
reads failed due to low quality: 8411414
reads failed due to too many N: 107416
reads failed due to too short: 747792
reads with adapter trimmed: 339598756
bases trimmed due to adapters: 14014567898

Duplication rate: 51.7918%

Insert size peak (evaluated by paired-end reads): 111

JSON report: aih-tih-sc-d5506e-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-d5506e-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-d5506e-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-d5506e-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-d5506e-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-d5506e-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-d5506e-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-d5506e-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 773 seconds