Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44473147963(98.1747%)
Q30 bases: 43056628099(95.0477%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44454043235(98.1325%)
Q30 bases: 42823489376(94.5331%)

Read1 after filtering:
total reads: 295160853
total bases: 37398899046
Q20 bases: 37213737660(99.5049%)
Q30 bases: 36496148214(97.5862%)

Read2 after filtering:
total reads: 295160853
total bases: 37447969026
Q20 bases: 37224265062(99.4026%)
Q30 bases: 36428427053(97.2774%)

Filtering result:
reads passed filter: 590321706
reads failed due to low quality: 9283868
reads failed due to too many N: 126728
reads failed due to too short: 267698
reads with adapter trimmed: 361597908
bases trimmed due to adapters: 14437507274

Duplication rate: 35.3416%

Insert size peak (evaluated by paired-end reads): 115

JSON report: aih-tih-sc-3924cb-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-3924cb-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-3924cb-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-3924cb-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-3924cb-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-3924cb-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-3924cb-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-3924cb-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 635 seconds