Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 124403025
total bases: 18784856775
Q20 bases: 18403852956(97.9718%)
Q30 bases: 17801838117(94.767%)

Read2 before filtering:
total reads: 124403025
total bases: 18784856775
Q20 bases: 18376917698(97.8284%)
Q30 bases: 17623931897(93.8199%)

Read1 after filtering:
total reads: 122090521
total bases: 14858550729
Q20 bases: 14806451361(99.6494%)
Q30 bases: 14555411662(97.9598%)

Read2 after filtering:
total reads: 122090521
total bases: 14886394569
Q20 bases: 14795555444(99.3898%)
Q30 bases: 14478341298(97.2589%)

Filtering result:
reads passed filter: 244181042
reads failed due to low quality: 4196252
reads failed due to too many N: 50324
reads failed due to too short: 378432
reads with adapter trimmed: 174326629
bases trimmed due to adapters: 7208495681

Duplication rate: 34.7045%

Insert size peak (evaluated by paired-end reads): 108

JSON report: aih-tih-sc-2f84cc-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-2f84cc-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-2f84cc-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-2f84cc-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-2f84cc-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-2f84cc-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-2f84cc-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-2f84cc-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 263 seconds