Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 223717864
total bases: 33781397464
Q20 bases: 33333517516(98.6742%)
Q30 bases: 32364914853(95.8069%)

Read2 before filtering:
total reads: 223717864
total bases: 33781397464
Q20 bases: 33115279895(98.0282%)
Q30 bases: 31841808476(94.2584%)

Read1 after filtering:
total reads: 219941146
total bases: 27451950945
Q20 bases: 27356155323(99.651%)
Q30 bases: 26900384165(97.9908%)

Read2 after filtering:
total reads: 219941146
total bases: 27494348669
Q20 bases: 27324822781(99.3834%)
Q30 bases: 26733298879(97.232%)

Filtering result:
reads passed filter: 439882292
reads failed due to low quality: 7000862
reads failed due to too many N: 94346
reads failed due to too short: 458228
reads with adapter trimmed: 289934804
bases trimmed due to adapters: 11596862020

Duplication rate: 44.5641%

Insert size peak (evaluated by paired-end reads): 111

JSON report: aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 642 seconds