Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44562907122(98.3729%)
Q30 bases: 43193725364(95.3504%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44413334630(98.0427%)
Q30 bases: 42738444960(94.3454%)

Read1 after filtering:
total reads: 294778940
total bases: 36884947825
Q20 bases: 36756003800(99.6504%)
Q30 bases: 36129121790(97.9509%)

Read2 after filtering:
total reads: 294778940
total bases: 36940617069
Q20 bases: 36725415132(99.4174%)
Q30 bases: 35950895557(97.3208%)

Filtering result:
reads passed filter: 589557880
reads failed due to low quality: 9939364
reads failed due to too many N: 125814
reads failed due to too short: 376942
reads with adapter trimmed: 378560220
bases trimmed due to adapters: 15362678034

Duplication rate: 35.1276%

Insert size peak (evaluated by paired-end reads): 115

JSON report: aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 695 seconds