Detecting adapter sequence for read1... >Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer GATCGGAAGAGCACACGTCTGAACTCCAGTCAC Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 959867 total bases: 144939917 Q20 bases: 125321474(86.4644%) Q30 bases: 96421127(66.5249%) Read2 before filtering: total reads: 959867 total bases: 144939917 Q20 bases: 138308101(95.4244%) Q30 bases: 112309537(77.487%) Read1 after filtering: total reads: 23328 total bases: 2724352 Q20 bases: 2518318(92.4373%) Q30 bases: 2205704(80.9625%) Read2 after filtering: total reads: 23328 total bases: 2739696 Q20 bases: 2644388(96.5212%) Q30 bases: 2398770(87.5561%) Filtering result: reads passed filter: 46656 reads failed due to low quality: 55308 reads failed due to too many N: 10 reads failed due to too short: 1817760 reads with adapter trimmed: 962432 bases trimmed due to adapters: 139260251 Duplication rate: 65.8145% Insert size peak (evaluated by paired-end reads): 151 JSON report: NTC_0001_0001_B23WHYVLT4_1.fastp.json HTML report: NTC_0001_0001_B23WHYVLT4_1.fastp.html fastp --in1 NTC_0001_0001_B23WHYVLT4_1_1.fastq.gz --in2 NTC_0001_0001_B23WHYVLT4_1_2.fastq.gz --out1 NTC_0001_0001_B23WHYVLT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_B23WHYVLT4_1_2.fastp.fastq.gz --json NTC_0001_0001_B23WHYVLT4_1.fastp.json --html NTC_0001_0001_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 100000000 fastp v0.23.4, time used: 8 seconds