File Info

Filename
NTC_0001_0001_A23WJ53LT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0019/A23WJ53LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/NTC_0001_0001_A23WJ53LT4_1.fastp.log
Size
1.5 KB
Published
Jun 08, 2026 12:38 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 57079
total bases: 8618929
Q20 bases: 7367583(85.4814%)
Q30 bases: 5398450(62.6348%)

Read2 before filtering:
total reads: 57079
total bases: 8618929
Q20 bases: 8157433(94.6456%)
Q30 bases: 6593342(76.4984%)

Read1 after filtering:
total reads: 1799
total bases: 187863
Q20 bases: 176564(93.9855%)
Q30 bases: 157134(83.6429%)

Read2 after filtering:
total reads: 1799
total bases: 190876
Q20 bases: 185803(97.3423%)
Q30 bases: 171245(89.7153%)

Filtering result:
reads passed filter: 3598
reads failed due to low quality: 4500
reads failed due to too many N: 0
reads failed due to too short: 106060
reads with adapter trimmed: 58150
bases trimmed due to adapters: 2114452

Duplication rate: 43.403%

Insert size peak (evaluated by paired-end reads): 78

JSON report: NTC_0001_0001_A23WJ53LT4_1.fastp.json
HTML report: NTC_0001_0001_A23WJ53LT4_1.fastp.html

fastp --in1 NTC_0001_0001_A23WJ53LT4_1_1.fastq.gz --in2 NTC_0001_0001_A23WJ53LT4_1_2.fastq.gz --out1 NTC_0001_0001_A23WJ53LT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_A23WJ53LT4_1_2.fastp.fastq.gz --json NTC_0001_0001_A23WJ53LT4_1.fastp.json --html NTC_0001_0001_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 2 seconds