Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 841936
total bases: 127132336
Q20 bases: 117201575(92.1886%)
Q30 bases: 104977658(82.5735%)

Read2 before filtering:
total reads: 841936
total bases: 127132336
Q20 bases: 122613616(96.4457%)
Q30 bases: 111939544(88.0496%)

Read1 after filtering:
total reads: 698690
total bases: 63987076
Q20 bases: 63675603(99.5132%)
Q30 bases: 62350297(97.442%)

Read2 after filtering:
total reads: 698690
total bases: 64232289
Q20 bases: 63776943(99.2911%)
Q30 bases: 62254457(96.9208%)

Filtering result:
reads passed filter: 1397380
reads failed due to low quality: 34782
reads failed due to too many N: 128
reads failed due to too short: 251582
reads with adapter trimmed: 1474849
bases trimmed due to adapters: 88008735

Duplication rate: 27.3956%

Insert size peak (evaluated by paired-end reads): 86

JSON report: aih-tih-sc-331e97-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-331e97-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-331e97-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-331e97-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-331e97-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-331e97-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-331e97-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-331e97-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 6 seconds