MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-08, 13:07 UTC based on data in: /tmp/nxf.DNf3rWS75B

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₁ columns.

Sample Name	Total Reads	Expected Distinct	Unique Reads	Frac Antisense	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	ChrY Signature Score	RNA contaminated	RNA contamination %	Frag Length	% Aligned	M Aligned	Duplication	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_HD789_01_RNA_13_A23WJ53LT4_1	9999000000	430685432	576317292	0.9445	593424124	0.00%	0.45%	326980945	0.95%	0.97%	0.05%	0.03%	309065374	156947548	15438100	4310666	678.16	264.00	0.71%	0.61%	0.98	0.000	174.4bp	157.0bp	0.01%	1.72%	0.78%	0.00%	0.02%	4.96%	1.10%	0.00%	3.92	Yes	63.73%				45.1%	91.0%	96.4%	286.1M	33.9%	97.5%	78893.2Mb	593.4M	55.4%	98.9%	39.5%
FFPE_HD789_01_RNA_13_A23WJ53LT4_1_1																																				174.4bp	98.1%	291.0M												87.6%	54%	151bp	151bp	18%	464.6M
FFPE_HD789_01_RNA_13_A23WJ53LT4_1_2																																																		86.8%	55%	151bp	151bp	18%	464.6M
FFPE_HD789_01_RNA_13_A23WJ53LT4_1_trimmed_1																																																		84.9%	54%	136bp	151bp	9%	296.7M	84.9%	54%	136bp	151bp	9%	296.7M
FFPE_HD789_01_RNA_13_A23WJ53LT4_1_trimmed_2																																																		85.0%	55%	136bp	151bp	9%	296.7M	85.0%	55%	136bp	151bp	9%	296.7M
FFPE_V4_0002_RNA_0006_A23WJ53LT4_1	9999000000	303324144	573285656	0.9671	593256648	0.01%	0.52%	284722813	0.93%	0.96%	0.06%	0.04%	265098551	134646702	16352999	5235732	547.88	134.00	0.60%	0.52%	0.98	0.000	161.9bp	146.0bp	0.01%	1.80%	1.26%	0.00%	0.02%	4.90%	1.75%	0.00%	6.68	No	0.00%				52.3%	89.5%	95.8%	284.3M	36.3%	97.4%	77309.8Mb	593.3M	55.2%	98.9%	45.8%
FFPE_V4_0002_RNA_0006_A23WJ53LT4_1_1																																				161.9bp	96.9%	287.4M												86.9%	54%	151bp	151bp	18%	329.8M
FFPE_V4_0002_RNA_0006_A23WJ53LT4_1_2																																																		86.2%	55%	151bp	151bp	18%	329.8M
FFPE_V4_0002_RNA_0006_A23WJ53LT4_1_trimmed_1																																																		86.4%	54%	134bp	151bp	9%	296.6M	86.4%	54%	134bp	151bp	9%	296.6M
FFPE_V4_0002_RNA_0006_A23WJ53LT4_1_trimmed_2																																																		86.6%	55%	134bp	151bp	9%	296.6M	86.6%	55%	134bp	151bp	9%	296.6M
NTC_0001_0001_A23WJ53LT4_1	9999000000	9495	832	0.7100	3598	0.51%	0.12%	3154	0.14%	0.34%	0.28%	0.66%	437	221	882	425	0.00	0.00	0.00%	0.00%	0.92	0.000	85.8bp	31.0bp	0.00%	0.60%	0.60%	0.00%	0.00%	1.40%	1.06%	0.00%	0.00	Skipped	N/A%				25.2%	6.0%	18.8%	0.0M	43.4%	86.7%	0.3Mb	0.0M	68.6%	3.2%	50.9%
NTC_0001_0001_A23WJ53LT4_1_1																																				85.8bp	19.1%	0.0M												97.2%	75%	151bp	151bp	55%	0.1M
NTC_0001_0001_A23WJ53LT4_1_2																																																		94.4%	97%	151bp	151bp	55%	0.1M
NTC_0001_0001_A23WJ53LT4_1_trimmed_1																																																		46.6%	64%	104bp	112bp	45%	0.0M	46.6%	64%	104bp	112bp	45%	0.0M
NTC_0001_0001_A23WJ53LT4_1_trimmed_2																																																		50.6%	72%	106bp	112bp	55%	0.0M	50.6%	72%	106bp	112bp	55%	0.0M
aih-tih-sc-00d05f-R1_A23WJ53LT4_1	9999000000	96627343	441557689	0.9474	457288686	0.01%	0.73%	123159798	0.91%	0.94%	0.07%	0.06%	111873435	56490836	8779708	3377883	202.29	93.00	0.67%	0.48%	0.98	0.000	143.3bp	132.0bp	0.01%	0.71%	0.37%	0.00%	0.02%	2.35%	0.62%	0.00%	0.00	No	0.00%				73.5%	88.4%	95.7%	218.9M	51.8%	97.5%	57007.0Mb	457.3M	57.0%	98.8%	58.1%
aih-tih-sc-00d05f-R1_A23WJ53LT4_1_1																																				143.3bp	98.0%	224.1M												86.3%	55%	151bp	151bp	18%	231.4M
aih-tih-sc-00d05f-R1_A23WJ53LT4_1_2																																																		85.1%	56%	151bp	151bp	18%	231.4M
aih-tih-sc-00d05f-R1_A23WJ53LT4_1_trimmed_1																																																		86.4%	56%	128bp	137bp	18%	228.6M	86.4%	56%	128bp	137bp	18%	228.6M
aih-tih-sc-00d05f-R1_A23WJ53LT4_1_trimmed_2																																																		86.1%	57%	128bp	137bp	9%	228.6M	86.1%	57%	128bp	137bp	9%	228.6M
aih-tih-sc-0419d4-R1_A23WJ53LT4_1	9999000000	85319592	366504615	0.9005	379846110	0.01%	0.74%	100432667	0.91%	0.94%	0.07%	0.06%	91465766	46003770	7042737	2881389	140.11	60.00	0.61%	0.39%	0.98	0.000	124.9bp	116.0bp	0.01%	1.09%	0.72%	0.00%	0.01%	3.06%	0.98%	0.00%	0.01	No	0.00%				73.9%	88.2%	95.4%	181.3M	46.9%	97.6%	43707.3Mb	379.8M	55.9%	98.7%	73.3%
aih-tih-sc-0419d4-R1_A23WJ53LT4_1_1																																				124.9bp	98.1%	186.3M												84.3%	54%	151bp	151bp	18%	192.5M
aih-tih-sc-0419d4-R1_A23WJ53LT4_1_2																																																		83.2%	55%	151bp	151bp	18%	192.5M
aih-tih-sc-0419d4-R1_A23WJ53LT4_1_trimmed_1																																																		84.4%	55%	118bp	117bp	9%	189.9M	84.4%	55%	118bp	117bp	9%	189.9M
aih-tih-sc-0419d4-R1_A23WJ53LT4_1_trimmed_2																																																		84.2%	56%	118bp	117bp	9%	189.9M	84.2%	56%	118bp	117bp	9%	189.9M
aih-tih-sc-06a169-R1_A23WJ53LT4_1	9999000000	122053236	528582740	0.9471	549662368	0.01%	0.75%	139217153	0.90%	0.93%	0.08%	0.07%	124859571	62990593	11165218	4458374	216.63	91.00	0.65%	0.48%	0.98	0.000	138.8bp	127.0bp	0.01%	1.52%	0.48%	0.00%	0.03%	4.65%	0.77%	0.00%	0.01	No	0.00%				75.1%	87.3%	95.4%	262.2M	51.6%	97.5%	67277.6Mb	549.7M	55.7%	98.6%	61.1%
aih-tih-sc-06a169-R1_A23WJ53LT4_1_1																																				138.8bp	97.8%	268.7M												88.1%	54%	151bp	151bp	18%	278.8M
aih-tih-sc-06a169-R1_A23WJ53LT4_1_2																																																		86.8%	55%	151bp	151bp	18%	278.8M
aih-tih-sc-06a169-R1_A23WJ53LT4_1_trimmed_1																																																		88.1%	55%	125bp	132bp	9%	274.8M	88.1%	55%	125bp	132bp	9%	274.8M
aih-tih-sc-06a169-R1_A23WJ53LT4_1_trimmed_2																																																		88.0%	55%	126bp	132bp	9%	274.8M	88.0%	55%	126bp	132bp	9%	274.8M
aih-tih-sc-0992e4-R1_A23WJ53LT4_1	9999000000	311146618	576111052	0.9102	593677570	0.01%	0.53%	278145390	0.94%	0.97%	0.05%	0.03%	261984346	132484419	12892174	4225603	509.13	231.00	0.76%	0.64%	0.97	0.000	146.6bp	134.0bp	0.00%	0.46%	0.46%	0.00%	0.01%	1.52%	0.73%	0.00%	5.98	No	0.00%				53.4%	90.7%	96.1%	285.2M	37.0%	97.4%	74979.5Mb	593.7M	56.9%	98.9%	54.6%
aih-tih-sc-0992e4-R1_A23WJ53LT4_1_1																																				146.6bp	98.3%	291.9M												88.7%	55%	151bp	151bp	18%	537.5M
aih-tih-sc-0992e4-R1_A23WJ53LT4_1_2																																																		87.8%	56%	151bp	151bp	18%	537.5M
aih-tih-sc-0992e4-R1_A23WJ53LT4_1_trimmed_1																																																		84.9%	56%	130bp	142bp	9%	296.8M	84.9%	56%	130bp	142bp	9%	296.8M
aih-tih-sc-0992e4-R1_A23WJ53LT4_1_trimmed_2																																																		85.0%	57%	130bp	142bp	18%	296.8M	85.0%	57%	130bp	142bp	18%	296.8M
aih-tih-sc-09b6a3-R1_A23WJ53LT4_1	9999000000	76082894	443479709	0.9119	462391862	0.01%	0.80%	90969462	0.88%	0.92%	0.09%	0.08%	80065721	40172492	8366200	3667422	117.41	48.00	0.58%	0.34%	0.98	0.000	118.0bp	109.0bp	0.03%	1.30%	0.50%	0.00%	0.05%	3.94%	0.78%	0.00%	0.02	No	0.00%				80.8%	85.9%	95.0%	219.5M	47.6%	97.6%	51283.4Mb	462.4M	56.0%	98.6%	77.2%
aih-tih-sc-09b6a3-R1_A23WJ53LT4_1_1																																				118.0bp	97.9%	226.4M												87.8%	54%	151bp	151bp	18%	234.4M
aih-tih-sc-09b6a3-R1_A23WJ53LT4_1_2																																																		86.3%	55%	151bp	151bp	27%	234.4M
aih-tih-sc-09b6a3-R1_A23WJ53LT4_1_trimmed_1																																																		87.9%	55%	114bp	112bp	9%	231.2M	87.9%	55%	114bp	112bp	9%	231.2M
aih-tih-sc-09b6a3-R1_A23WJ53LT4_1_trimmed_2																																																		87.3%	56%	114bp	112bp	9%	231.2M	87.3%	56%	114bp	112bp	9%	231.2M
aih-tih-sc-0ce15f-R1_A23WJ53LT4_1	9999000000	99008331	325063676	0.9235	340915472	0.01%	0.67%	113427158	0.92%	0.95%	0.06%	0.05%	104269894	52422794	6987165	2856831	163.49	77.00	0.65%	0.45%	0.98	0.000	119.1bp	110.0bp	0.01%	1.16%	0.47%	0.00%	0.01%	3.46%	0.75%	0.00%	6.10	No	0.00%				67.2%	86.2%	94.5%	161.0M	39.6%	97.5%	38464.9Mb	340.9M	55.3%	98.7%	75.3%
aih-tih-sc-0ce15f-R1_A23WJ53LT4_1_1																																				119.1bp	97.9%	166.8M												81.5%	54%	151bp	151bp	18%	172.6M
aih-tih-sc-0ce15f-R1_A23WJ53LT4_1_2																																																		80.3%	55%	151bp	151bp	27%	172.6M
aih-tih-sc-0ce15f-R1_A23WJ53LT4_1_trimmed_1																																																		81.5%	55%	116bp	117bp	9%	170.5M	81.5%	55%	116bp	117bp	9%	170.5M
aih-tih-sc-0ce15f-R1_A23WJ53LT4_1_trimmed_2																																																		81.3%	55%	116bp	117bp	9%	170.5M	81.3%	55%	116bp	117bp	9%	170.5M
aih-tih-sc-12b72b-R1_A23WJ53LT4_1	9999000000	110067391	570985495	0.9203	591688144	0.01%	0.76%	140087608	0.92%	0.95%	0.06%	0.05%	128514304	64516727	8481870	3453499	198.10	86.00	0.66%	0.47%	0.98	0.000	119.7bp	110.0bp	0.02%	0.73%	0.57%	0.00%	0.04%	2.36%	0.90%	0.00%	5.96	No	0.00%				76.7%	88.3%	95.3%	282.1M	45.9%	97.5%	66723.2Mb	591.7M	57.0%	98.6%	75.5%
aih-tih-sc-12b72b-R1_A23WJ53LT4_1_1																																				119.7bp	98.5%	291.4M												88.2%	55%	151bp	151bp	18%	312.3M
aih-tih-sc-12b72b-R1_A23WJ53LT4_1_2																																																		87.1%	56%	151bp	151bp	18%	312.3M
aih-tih-sc-12b72b-R1_A23WJ53LT4_1_trimmed_1																																																		88.0%	56%	116bp	117bp	9%	295.8M	88.0%	56%	116bp	117bp	9%	295.8M
aih-tih-sc-12b72b-R1_A23WJ53LT4_1_trimmed_2																																																		88.0%	57%	116bp	117bp	9%	295.8M	88.0%	57%	116bp	117bp	9%	295.8M
aih-tih-sc-1351d2-R1_A23WJ53LT4_1	9999000000	81075468	483353870	0.9354	500763508	0.00%	0.80%	102297776	0.91%	0.95%	0.07%	0.05%	92803685	46813166	7179034	2656724	159.84	49.00	0.57%	0.37%	0.98	0.000	132.8bp	121.0bp	0.01%	1.21%	0.49%	0.00%	0.01%	3.37%	0.69%	0.00%	0.00	No	0.00%				79.9%	85.8%	95.3%	238.6M	54.4%	97.5%	59981.4Mb	500.8M	54.3%	99.0%	64.9%
aih-tih-sc-1351d2-R1_A23WJ53LT4_1_1																																				132.8bp	98.3%	246.2M												89.8%	53%	151bp	151bp	18%	253.0M
aih-tih-sc-1351d2-R1_A23WJ53LT4_1_2																																																		88.2%	54%	151bp	151bp	27%	253.0M
aih-tih-sc-1351d2-R1_A23WJ53LT4_1_trimmed_1																																																		89.9%	53%	123bp	127bp	9%	250.4M	89.9%	53%	123bp	127bp	9%	250.4M
aih-tih-sc-1351d2-R1_A23WJ53LT4_1_trimmed_2																																																		89.0%	54%	123bp	127bp	18%	250.4M	89.0%	54%	123bp	127bp	18%	250.4M
aih-tih-sc-19e09e-R1_A23WJ53LT4_1	9999000000	98415491	438409600	0.9495	453109202	0.01%	0.74%	118538948	0.92%	0.95%	0.06%	0.05%	108616179	54686838	7618881	3050066	171.86	72.00	0.63%	0.43%	0.98	0.000	123.3bp	114.0bp	0.02%	1.32%	0.55%	0.00%	0.03%	3.70%	0.76%	0.00%	4.29	No	0.00%				74.2%	88.6%	95.6%	216.6M	46.8%	97.7%	52252.9Mb	453.1M	54.8%	98.9%	74.0%
aih-tih-sc-19e09e-R1_A23WJ53LT4_1_1																																				123.3bp	98.4%	223.0M												87.0%	53%	151bp	151bp	18%	229.0M
aih-tih-sc-19e09e-R1_A23WJ53LT4_1_2																																																		85.5%	54%	151bp	151bp	27%	229.0M
aih-tih-sc-19e09e-R1_A23WJ53LT4_1_trimmed_1																																																		87.0%	54%	118bp	117bp	9%	226.6M	87.0%	54%	118bp	117bp	9%	226.6M
aih-tih-sc-19e09e-R1_A23WJ53LT4_1_trimmed_2																																																		86.4%	55%	118bp	117bp	9%	226.6M	86.4%	55%	118bp	117bp	9%	226.6M
aih-tih-sc-1dd7a6-R1_A23WJ53LT4_1	9999000000	140687786	572520753	0.9435	591657642	0.00%	0.71%	171235524	0.92%	0.95%	0.06%	0.05%	158097255	79643954	10427036	4006349	270.34	120.00	0.70%	0.54%	0.98	0.000	131.3bp	120.0bp	0.01%	0.91%	0.61%	0.00%	0.01%	2.84%	0.95%	0.00%	0.01	No	0.00%				71.4%	89.3%	95.8%	283.5M	46.1%	97.5%	70237.5Mb	591.7M	57.5%	98.6%	66.0%
aih-tih-sc-1dd7a6-R1_A23WJ53LT4_1_1																																				131.3bp	98.4%	291.1M												88.9%	56%	151bp	151bp	18%	392.4M
aih-tih-sc-1dd7a6-R1_A23WJ53LT4_1_2																																																		87.8%	56%	151bp	151bp	18%	392.4M
aih-tih-sc-1dd7a6-R1_A23WJ53LT4_1_trimmed_1																																																		87.1%	57%	122bp	127bp	9%	295.8M	87.1%	57%	122bp	127bp	9%	295.8M
aih-tih-sc-1dd7a6-R1_A23WJ53LT4_1_trimmed_2																																																		87.2%	57%	122bp	127bp	9%	295.8M	87.2%	57%	122bp	127bp	9%	295.8M
aih-tih-sc-1ffee4-R1_A23WJ53LT4_1	9999000000	283801177	519989115	0.9513	534802836	0.00%	0.53%	252342347	0.94%	0.97%	0.05%	0.03%	237033902	120000968	12640773	4156205	474.67	242.00	0.75%	0.64%	0.98	0.000	154.8bp	139.0bp	0.01%	0.92%	0.43%	0.00%	0.01%	3.18%	0.73%	0.00%	0.02	No	0.00%				53.1%	90.9%	96.3%	257.5M	37.9%	97.6%	68492.3Mb	534.8M	55.5%	99.0%	50.1%
aih-tih-sc-1ffee4-R1_A23WJ53LT4_1_1																																				154.8bp	98.2%	262.7M												84.7%	54%	151bp	151bp	18%	270.2M
aih-tih-sc-1ffee4-R1_A23WJ53LT4_1_2																																																		84.1%	55%	151bp	151bp	18%	270.2M
aih-tih-sc-1ffee4-R1_A23WJ53LT4_1_trimmed_1																																																		84.7%	55%	131bp	151bp	9%	267.4M	84.7%	55%	131bp	151bp	9%	267.4M
aih-tih-sc-1ffee4-R1_A23WJ53LT4_1_trimmed_2																																																		84.9%	55%	131bp	151bp	9%	267.4M	84.9%	55%	131bp	151bp	9%	267.4M
aih-tih-sc-2482ef-R1_A23WJ53LT4_1	9999000000	10088436	58530473	0.8713	61130476	0.01%	0.83%	10509239	0.86%	0.91%	0.10%	0.09%	8989754	4509407	1029891	441293	13.52	4.00	0.11%	0.01%	0.97	0.000	122.4bp	113.0bp	0.01%	0.38%	0.16%	0.00%	0.01%	1.30%	0.30%	0.00%	0.01	No	0.00%				83.5%	85.0%	94.7%	28.9M	52.8%	97.3%	6969.5Mb	61.1M	59.9%	98.2%	73.1%
aih-tih-sc-2482ef-R1_A23WJ53LT4_1_1																																				122.4bp	97.9%	29.9M												85.1%	57%	151bp	151bp	18%	31.1M
aih-tih-sc-2482ef-R1_A23WJ53LT4_1_2																																																		83.2%	58%	151bp	151bp	18%	31.1M
aih-tih-sc-2482ef-R1_A23WJ53LT4_1_trimmed_1																																																		85.1%	59%	117bp	117bp	9%	30.6M	85.1%	59%	117bp	117bp	9%	30.6M
aih-tih-sc-2482ef-R1_A23WJ53LT4_1_trimmed_2																																																		84.4%	60%	117bp	117bp	9%	30.6M	84.4%	60%	117bp	117bp	9%	30.6M
aih-tih-sc-2798bb-R1_A23WJ53LT4_1	9999000000	229999513	572502431	0.9622	592854336	0.00%	0.57%	252768067	0.94%	0.97%	0.05%	0.03%	237338794	119968634	12748316	4318189	452.53	221.00	0.74%	0.62%	0.98	0.000	146.9bp	134.0bp	0.02%	1.46%	0.63%	0.00%	0.03%	4.25%	0.92%	0.00%	0.01	No	0.00%				57.6%	88.9%	95.7%	283.7M	40.9%	97.5%	74762.6Mb	592.9M	54.3%	98.8%	55.9%
aih-tih-sc-2798bb-R1_A23WJ53LT4_1_1																																				146.9bp	98.2%	291.2M												86.6%	53%	151bp	151bp	18%	410.3M
aih-tih-sc-2798bb-R1_A23WJ53LT4_1_2																																																		85.8%	54%	151bp	151bp	18%	410.3M
aih-tih-sc-2798bb-R1_A23WJ53LT4_1_trimmed_1																																																		84.3%	54%	129bp	142bp	9%	296.4M	84.3%	54%	129bp	142bp	9%	296.4M
aih-tih-sc-2798bb-R1_A23WJ53LT4_1_trimmed_2																																																		84.5%	54%	129bp	142bp	9%	296.4M	84.5%	54%	129bp	142bp	9%	296.4M
aih-tih-sc-284856-R1_A23WJ53LT4_1	9999000000	222901156	134264789	0.9479	138423934	0.00%	0.28%	99469048	0.96%	0.97%	0.04%	0.03%	95018503	47953894	3803590	1240905	182.35	80.00	0.65%	0.45%	0.98	0.000	146.6bp	134.0bp	0.01%	1.51%	0.44%	0.00%	0.01%	4.73%	0.72%	0.00%	0.01	No	0.00%				28.3%	90.0%	96.0%	66.4M	18.6%	97.6%	17339.2Mb	138.4M	54.9%	98.9%	56.7%
aih-tih-sc-284856-R1_A23WJ53LT4_1_1																																				146.6bp	98.3%	68.1M												69.7%	54%	151bp	151bp	18%	70.0M
aih-tih-sc-284856-R1_A23WJ53LT4_1_2																																																		69.2%	55%	151bp	151bp	18%	70.0M
aih-tih-sc-284856-R1_A23WJ53LT4_1_trimmed_1																																																		69.7%	54%	128bp	142bp	9%	69.2M	69.7%	54%	128bp	142bp	9%	69.2M
aih-tih-sc-284856-R1_A23WJ53LT4_1_trimmed_2																																																		69.9%	55%	128bp	142bp	9%	69.2M	69.9%	55%	128bp	142bp	9%	69.2M
aih-tih-sc-2905df-R1_A23WJ53LT4_1	9999000000	301296503	575454864	0.9409	593720878	0.00%	0.52%	284160792	0.94%	0.97%	0.05%	0.03%	267734201	135406311	13874364	4629877	521.13	192.00	0.68%	0.58%	0.98	0.000	151.1bp	137.0bp	0.02%	2.10%	0.51%	0.00%	0.03%	6.05%	0.86%	0.00%	3.54	No	0.00%				52.4%	90.2%	96.1%	285.2M	36.8%	97.6%	75414.1Mb	593.7M	54.2%	99.0%	53.7%
aih-tih-sc-2905df-R1_A23WJ53LT4_1_1																																				151.1bp	98.0%	290.8M												84.9%	53%	151bp	151bp	18%	317.6M
aih-tih-sc-2905df-R1_A23WJ53LT4_1_2																																																		84.1%	54%	151bp	151bp	18%	317.6M
aih-tih-sc-2905df-R1_A23WJ53LT4_1_trimmed_1																																																		84.6%	53%	130bp	142bp	9%	296.9M	84.6%	53%	130bp	142bp	9%	296.9M
aih-tih-sc-2905df-R1_A23WJ53LT4_1_trimmed_2																																																		84.5%	54%	130bp	147bp	9%	296.9M	84.5%	54%	130bp	147bp	9%	296.9M
aih-tih-sc-2a8dd7-R1_A23WJ53LT4_1	9999000000	236778301	571194871	0.9051	593593464	0.00%	0.57%	252786093	0.94%	0.96%	0.05%	0.04%	237441947	119847163	12519194	4492916	431.89	163.00	0.67%	0.56%	0.98	0.000	137.0bp	126.0bp	0.01%	1.15%	0.47%	0.00%	0.01%	3.49%	0.69%	0.00%	0.00	No	0.00%				57.7%	88.3%	95.3%	282.9M	36.8%	97.6%	72538.3Mb	593.6M	55.5%	98.9%	61.9%
aih-tih-sc-2a8dd7-R1_A23WJ53LT4_1_1																																				137.0bp	98.4%	291.9M												85.4%	54%	151bp	151bp	18%	408.9M
aih-tih-sc-2a8dd7-R1_A23WJ53LT4_1_2																																																		84.4%	55%	151bp	151bp	18%	408.9M
aih-tih-sc-2a8dd7-R1_A23WJ53LT4_1_trimmed_1																																																		82.9%	55%	125bp	132bp	9%	296.8M	82.9%	55%	125bp	132bp	9%	296.8M
aih-tih-sc-2a8dd7-R1_A23WJ53LT4_1_trimmed_2																																																		82.8%	55%	125bp	132bp	9%	296.8M	82.8%	55%	125bp	132bp	9%	296.8M
aih-tih-sc-2ca847-R1_A23WJ53LT4_1	9999000000	88246876	322596102	0.8917	335158932	0.01%	0.69%	103927633	0.92%	0.95%	0.06%	0.05%	95622615	48104825	6322112	2542318	155.25	71.00	0.64%	0.42%	0.98	0.000	126.8bp	117.0bp	0.01%	0.66%	0.43%	0.00%	0.02%	2.05%	0.68%	0.00%	0.01	No	0.00%				69.4%	87.9%	95.3%	159.7M	44.1%	97.5%	39133.7Mb	335.2M	56.6%	98.8%	71.1%
aih-tih-sc-2ca847-R1_A23WJ53LT4_1_1																																				126.8bp	98.2%	164.6M												84.0%	54%	151bp	151bp	18%	169.6M
aih-tih-sc-2ca847-R1_A23WJ53LT4_1_2																																																		82.8%	56%	151bp	151bp	18%	169.6M
aih-tih-sc-2ca847-R1_A23WJ53LT4_1_trimmed_1																																																		84.0%	56%	120bp	122bp	9%	167.6M	84.0%	56%	120bp	122bp	9%	167.6M
aih-tih-sc-2ca847-R1_A23WJ53LT4_1_trimmed_2																																																		83.7%	56%	120bp	122bp	9%	167.6M	83.7%	56%	120bp	122bp	9%	167.6M
aih-tih-sc-2d4b78-R1_A23WJ53LT4_1	9999000000	315879940	572397571	0.9509	593265416	0.01%	0.53%	281459858	0.93%	0.96%	0.06%	0.04%	261645327	132479467	16688361	5909269	520.09	229.00	0.72%	0.61%	0.97	0.000	154.2bp	140.0bp	0.01%	0.53%	0.27%	0.00%	0.02%	1.74%	0.41%	0.00%	0.01	No	0.00%				52.8%	88.7%	95.7%	283.9M	38.1%	97.4%	76234.8Mb	593.3M	54.8%	98.9%	50.1%
aih-tih-sc-2d4b78-R1_A23WJ53LT4_1_1																																				154.2bp	97.8%	290.2M												85.7%	54%	151bp	151bp	18%	323.8M
aih-tih-sc-2d4b78-R1_A23WJ53LT4_1_2																																																		84.8%	54%	151bp	151bp	18%	323.8M
aih-tih-sc-2d4b78-R1_A23WJ53LT4_1_trimmed_1																																																		85.2%	54%	132bp	151bp	9%	296.6M	85.2%	54%	132bp	151bp	9%	296.6M
aih-tih-sc-2d4b78-R1_A23WJ53LT4_1_trimmed_2																																																		85.3%	55%	132bp	151bp	9%	296.6M	85.3%	55%	132bp	151bp	9%	296.6M
aih-tih-sc-331e97-R1_A23WJ53LT4_1	9999000000	440118	1276973	0.7732	1397380	0.02%	0.73%	380649	0.79%	0.84%	0.16%	0.16%	299035	149420	59038	28165	0.33	0.00	0.00%	0.00%	0.97	0.000	91.6bp	88.0bp	0.00%	0.60%	0.15%	0.00%	0.00%	1.78%	0.26%	0.00%	0.00	Skipped	N/A%				74.0%	69.0%	90.0%	0.6M	27.4%	97.2%	124.6Mb	1.4M	61.2%	83.0%	87.6%
aih-tih-sc-331e97-R1_A23WJ53LT4_1_1																																				91.6bp	94.3%	0.7M												75.8%	59%	151bp	151bp	36%	0.8M
aih-tih-sc-331e97-R1_A23WJ53LT4_1_2																																																		74.2%	65%	151bp	151bp	55%	0.8M
aih-tih-sc-331e97-R1_A23WJ53LT4_1_trimmed_1																																																		71.5%	61%	92bp	87bp	18%	0.7M	71.5%	61%	92bp	87bp	18%	0.7M
aih-tih-sc-331e97-R1_A23WJ53LT4_1_trimmed_2																																																		71.4%	61%	92bp	87bp	18%	0.7M	71.4%	61%	92bp	87bp	18%	0.7M
aih-tih-sc-33eb27-R1_A23WJ53LT4_1	9999000000	148432973	565081988	0.9170	593538366	0.00%	0.69%	185079021	0.93%	0.96%	0.05%	0.04%	172603425	86739470	9616825	3823521	276.46	118.00	0.68%	0.53%	0.98	0.000	120.1bp	112.0bp	0.01%	1.03%	0.60%	0.00%	0.02%	3.09%	0.87%	0.00%	3.56	No	0.00%				69.2%	85.2%	94.3%	279.9M	41.4%	97.5%	67381.4Mb	593.5M	55.9%	98.9%	76.2%
aih-tih-sc-33eb27-R1_A23WJ53LT4_1_1																																				120.1bp	98.6%	292.5M												88.2%	54%	151bp	151bp	18%	409.4M
aih-tih-sc-33eb27-R1_A23WJ53LT4_1_2																																																		87.0%	55%	151bp	151bp	18%	409.4M
aih-tih-sc-33eb27-R1_A23WJ53LT4_1_trimmed_1																																																		85.8%	55%	116bp	117bp	9%	296.8M	85.8%	55%	116bp	117bp	9%	296.8M
aih-tih-sc-33eb27-R1_A23WJ53LT4_1_trimmed_2																																																		85.6%	56%	117bp	117bp	9%	296.8M	85.6%	56%	117bp	117bp	9%	296.8M
aih-tih-sc-387c73-R1_A23WJ53LT4_1	9999000000	223400314	575587573	0.9150	593643342	0.01%	0.58%	247971433	0.94%	0.96%	0.05%	0.04%	232636390	117534937	12331825	4289252	437.76	231.00	0.75%	0.63%	0.98	0.000	144.4bp	132.0bp	0.00%	0.96%	0.42%	0.00%	0.01%	3.09%	0.67%	0.00%	0.01	Yes	1.22%				58.5%	90.4%	96.1%	285.2M	41.6%	97.6%	74408.6Mb	593.6M	55.1%	98.9%	57.1%
aih-tih-sc-387c73-R1_A23WJ53LT4_1_1																																				144.4bp	98.3%	291.8M												85.2%	53%	151bp	151bp	18%	324.3M
aih-tih-sc-387c73-R1_A23WJ53LT4_1_2																																																		84.4%	54%	151bp	151bp	18%	324.3M
aih-tih-sc-387c73-R1_A23WJ53LT4_1_trimmed_1																																																		84.6%	54%	128bp	142bp	9%	296.8M	84.6%	54%	128bp	142bp	9%	296.8M
aih-tih-sc-387c73-R1_A23WJ53LT4_1_trimmed_2																																																		84.7%	55%	128bp	142bp	9%	296.8M	84.7%	55%	128bp	142bp	9%	296.8M
aih-tih-sc-38a0a3-R1_A23WJ53LT4_1	9990000000	175427641	573699807	0.9275	591726580	0.00%	0.65%	207131222	0.94%	0.97%	0.05%	0.03%	194209482	98073826	10357964	3477005	363.19	171.00	0.73%	0.60%	0.98	0.000	143.2bp	130.0bp	0.00%	0.88%	0.50%	0.00%	0.01%	2.94%	0.81%	0.00%	0.02	No	0.00%				65.3%	90.3%	96.0%	284.2M	45.5%	97.5%	73855.1Mb	591.7M	57.4%	98.6%	56.1%
aih-tih-sc-38a0a3-R1_A23WJ53LT4_1_1																																				143.2bp	98.5%	291.3M												89.0%	55%	151bp	151bp	18%	440.1M
aih-tih-sc-38a0a3-R1_A23WJ53LT4_1_2																																																		87.8%	57%	151bp	151bp	27%	440.1M
aih-tih-sc-38a0a3-R1_A23WJ53LT4_1_trimmed_1																																																		86.3%	57%	128bp	142bp	18%	295.9M	86.3%	57%	128bp	142bp	18%	295.9M
aih-tih-sc-38a0a3-R1_A23WJ53LT4_1_trimmed_2																																																		86.3%	57%	128bp	142bp	18%	295.9M	86.3%	57%	128bp	142bp	18%	295.9M
aih-tih-sc-3a13e9-R1_A23WJ53LT4_1	9999000000	156456509	572199910	0.9499	592584764	0.01%	0.67%	197274097	0.93%	0.96%	0.05%	0.04%	183414126	92581977	10627542	3730934	340.42	116.00	0.66%	0.52%	0.98	0.000	144.7bp	132.0bp	0.01%	0.86%	0.74%	0.00%	0.01%	2.55%	1.04%	0.00%	0.00	No	0.00%				67.1%	88.7%	95.8%	283.8M	46.9%	97.4%	74017.7Mb	592.6M	58.3%	98.8%	57.5%
aih-tih-sc-3a13e9-R1_A23WJ53LT4_1_1																																				144.7bp	98.3%	291.1M												90.8%	57%	151bp	151bp	18%	509.6M
aih-tih-sc-3a13e9-R1_A23WJ53LT4_1_2																																																		89.6%	57%	151bp	151bp	18%	509.6M
aih-tih-sc-3a13e9-R1_A23WJ53LT4_1_trimmed_1																																																		87.7%	58%	128bp	137bp	9%	296.3M	87.7%	58%	128bp	137bp	9%	296.3M
aih-tih-sc-3a13e9-R1_A23WJ53LT4_1_trimmed_2																																																		87.6%	58%	128bp	137bp	9%	296.3M	87.6%	58%	128bp	137bp	9%	296.3M
aih-tih-sc-3a9c1f-R1_A23WJ53LT4_1	9999000000	93071023	564724128	0.9307	588866802	0.01%	0.81%	112613588	0.89%	0.93%	0.08%	0.07%	100718560	50716579	8780113	3527614	171.23	74.00	0.63%	0.44%	0.98	0.000	134.7bp	124.0bp	0.01%	1.28%	0.58%	0.00%	0.03%	3.92%	0.90%	0.00%	5.86	No	0.00%				81.3%	86.9%	95.1%	280.0M	55.5%	97.5%	70902.5Mb	588.9M	56.9%	98.8%	65.0%
aih-tih-sc-3a9c1f-R1_A23WJ53LT4_1_1																																				134.7bp	98.2%	289.0M												89.6%	55%	151bp	151bp	18%	298.0M
aih-tih-sc-3a9c1f-R1_A23WJ53LT4_1_2																																																		88.4%	56%	151bp	151bp	18%	298.0M
aih-tih-sc-3a9c1f-R1_A23WJ53LT4_1_trimmed_1																																																		89.7%	56%	123bp	127bp	9%	294.4M	89.7%	56%	123bp	127bp	9%	294.4M
aih-tih-sc-3a9c1f-R1_A23WJ53LT4_1_trimmed_2																																																		89.4%	57%	124bp	127bp	9%	294.4M	89.4%	57%	124bp	127bp	9%	294.4M
aih-tih-sc-3b54a2-R1_A23WJ53LT4_1	9999000000	168729762	396551455	0.9450	411533366	0.01%	0.56%	181446592	0.93%	0.95%	0.06%	0.05%	168229799	84632744	11099570	4612226	270.52	142.00	0.71%	0.56%	0.98	0.000	122.0bp	114.0bp	0.01%	0.68%	0.50%	0.00%	0.02%	2.00%	0.69%	0.00%	6.06	No	0.00%				56.2%	88.1%	95.3%	196.1M	33.2%	97.8%	47266.2Mb	411.5M	52.8%	99.0%	74.9%
aih-tih-sc-3b54a2-R1_A23WJ53LT4_1_1																																				122.0bp	97.9%	201.4M												81.0%	52%	151bp	151bp	18%	207.9M
aih-tih-sc-3b54a2-R1_A23WJ53LT4_1_2																																																		80.2%	52%	151bp	151bp	27%	207.9M
aih-tih-sc-3b54a2-R1_A23WJ53LT4_1_trimmed_1																																																		81.0%	52%	117bp	117bp	9%	205.8M	81.0%	52%	117bp	117bp	9%	205.8M
aih-tih-sc-3b54a2-R1_A23WJ53LT4_1_trimmed_2																																																		81.0%	52%	118bp	117bp	9%	205.8M	81.0%	52%	118bp	117bp	9%	205.8M
aih-tih-sc-3cac57-R1_A23WJ53LT4_1	9999000000	243094540	572162195	0.9406	593315508	0.01%	0.57%	257366928	0.94%	0.97%	0.05%	0.03%	241378840	122401053	12263681	3628028	491.07	236.00	0.77%	0.65%	0.98	0.000	160.6bp	145.0bp	0.01%	0.56%	0.44%	0.00%	0.01%	1.75%	0.69%	0.00%	5.87	No	0.00%				57.0%	88.6%	95.5%	283.3M	41.4%	97.5%	77345.8Mb	593.3M	57.2%	98.9%	46.7%
aih-tih-sc-3cac57-R1_A23WJ53LT4_1_1																																				160.6bp	97.6%	289.6M												88.3%	56%	151bp	151bp	18%	465.1M
aih-tih-sc-3cac57-R1_A23WJ53LT4_1_2																																																		87.0%	57%	151bp	151bp	18%	465.1M
aih-tih-sc-3cac57-R1_A23WJ53LT4_1_trimmed_1																																																		85.2%	56%	134bp	151bp	9%	296.7M	85.2%	56%	134bp	151bp	9%	296.7M
aih-tih-sc-3cac57-R1_A23WJ53LT4_1_trimmed_2																																																		84.9%	57%	134bp	151bp	9%	296.7M	84.9%	57%	134bp	151bp	9%	296.7M
aih-tih-sc-3e4d53-R1_A23WJ53LT4_1	9999000000	328876759	470301201	0.9131	487835368	0.01%	0.46%	262691687	0.94%	0.97%	0.05%	0.03%	247551827	125329760	12275314	3921979	498.64	229.00	0.73%	0.62%	0.98	0.000	155.3bp	141.0bp	0.01%	1.39%	0.61%	0.00%	0.02%	4.42%	1.00%	0.00%	0.02	No	0.00%				46.4%	88.9%	95.6%	233.2M	32.5%	97.5%	62690.9Mb	487.8M	55.1%	99.0%	49.7%
aih-tih-sc-3e4d53-R1_A23WJ53LT4_1_1																																				155.3bp	97.9%	238.9M												82.0%	54%	151bp	151bp	18%	246.4M
aih-tih-sc-3e4d53-R1_A23WJ53LT4_1_2																																																		81.8%	54%	151bp	151bp	18%	246.4M
aih-tih-sc-3e4d53-R1_A23WJ53LT4_1_trimmed_1																																																		82.1%	54%	132bp	151bp	9%	243.9M	82.1%	54%	132bp	151bp	9%	243.9M
aih-tih-sc-3e4d53-R1_A23WJ53LT4_1_trimmed_2																																																		82.5%	55%	132bp	151bp	9%	243.9M	82.5%	55%	132bp	151bp	9%	243.9M
aih-tih-sc-3eb8dd-R1_A23WJ53LT4_1	9999000000	243526946	418544250	0.9299	440741746	0.00%	0.51%	217736282	0.94%	0.97%	0.05%	0.03%	205217666	103636626	10383703	3593106	375.80	151.00	0.68%	0.56%	0.98	0.000	138.6bp	126.0bp	0.01%	1.57%	0.48%	0.00%	0.01%	4.61%	0.74%	0.00%	4.19	No	0.00%				50.8%	84.7%	94.1%	207.4M	32.8%	97.5%	54044.4Mb	440.7M	56.3%	98.9%	61.1%
aih-tih-sc-3eb8dd-R1_A23WJ53LT4_1_1																																				138.6bp	98.3%	216.5M												81.8%	54%	151bp	151bp	18%	222.7M
aih-tih-sc-3eb8dd-R1_A23WJ53LT4_1_2																																																		81.3%	56%	151bp	151bp	18%	222.7M
aih-tih-sc-3eb8dd-R1_A23WJ53LT4_1_trimmed_1																																																		81.9%	56%	126bp	132bp	9%	220.4M	81.9%	56%	126bp	132bp	9%	220.4M
aih-tih-sc-3eb8dd-R1_A23WJ53LT4_1_trimmed_2																																																		82.1%	56%	126bp	132bp	9%	220.4M	82.1%	56%	126bp	132bp	9%	220.4M
aih-tih-sc-408cca-R1_A23WJ53LT4_1	9999000000	122961806	481737880	0.9000	496973092	0.00%	0.70%	149405541	0.91%	0.94%	0.07%	0.06%	136310595	68727686	10853715	4306264	233.08	108.00	0.67%	0.51%	0.98	0.000	136.1bp	125.0bp	0.01%	0.78%	0.40%	0.00%	0.02%	2.36%	0.57%	0.00%	5.80	No	0.00%				70.3%	90.1%	96.1%	238.8M	48.0%	97.6%	60357.3Mb	497.0M	54.5%	98.6%	63.4%
aih-tih-sc-408cca-R1_A23WJ53LT4_1_1																																				136.1bp	97.9%	243.3M												85.9%	53%	151bp	151bp	18%	252.0M
aih-tih-sc-408cca-R1_A23WJ53LT4_1_2																																																		84.8%	54%	151bp	151bp	18%	252.0M
aih-tih-sc-408cca-R1_A23WJ53LT4_1_trimmed_1																																																		85.9%	54%	124bp	132bp	9%	248.5M	85.9%	54%	124bp	132bp	9%	248.5M
aih-tih-sc-408cca-R1_A23WJ53LT4_1_trimmed_2																																																		85.9%	54%	124bp	132bp	9%	248.5M	85.9%	54%	124bp	132bp	9%	248.5M
aih-tih-sc-41b5f1-R1_A23WJ53LT4_1	9990000000	37445367	249511025	0.9542	260094710	0.01%	0.85%	40056310	0.83%	0.89%	0.12%	0.11%	33266150	16728745	4806451	2113950	51.08	20.00	0.41%	0.13%	0.98	0.000	128.7bp	120.0bp	0.01%	1.08%	0.39%	0.00%	0.03%	3.38%	0.65%	0.00%	0.02	No	0.00%				85.2%	86.4%	95.0%	123.5M	56.7%	97.5%	30652.5Mb	260.1M	57.8%	98.6%	70.8%
aih-tih-sc-41b5f1-R1_A23WJ53LT4_1_1																																				128.7bp	97.5%	126.9M												88.1%	55%	151bp	151bp	18%	131.9M
aih-tih-sc-41b5f1-R1_A23WJ53LT4_1_2																																																		86.7%	56%	151bp	151bp	18%	131.9M
aih-tih-sc-41b5f1-R1_A23WJ53LT4_1_trimmed_1																																																		88.1%	57%	121bp	122bp	9%	130.0M	88.1%	57%	121bp	122bp	9%	130.0M
aih-tih-sc-41b5f1-R1_A23WJ53LT4_1_trimmed_2																																																		87.7%	58%	121bp	122bp	9%	130.0M	87.7%	58%	121bp	122bp	9%	130.0M
aih-tih-sc-431fe7-R1_A23WJ53LT4_1	9999000000	85752433	394130265	0.9359	409487286	0.01%	0.76%	98360426	0.89%	0.93%	0.08%	0.07%	87894502	44277346	7812687	3193298	148.30	67.00	0.64%	0.41%	0.97	0.000	134.1bp	124.0bp	0.00%	0.65%	0.25%	0.00%	0.01%	2.10%	0.41%	0.00%	0.01	No	0.00%				76.5%	88.0%	95.4%	195.4M	51.2%	97.3%	49382.7Mb	409.5M	57.5%	98.8%	65.6%
aih-tih-sc-431fe7-R1_A23WJ53LT4_1_1																																				134.1bp	97.6%	199.9M												86.2%	56%	151bp	151bp	18%	207.2M
aih-tih-sc-431fe7-R1_A23WJ53LT4_1_2																																																		84.8%	57%	151bp	151bp	18%	207.2M
aih-tih-sc-431fe7-R1_A23WJ53LT4_1_trimmed_1																																																		86.3%	57%	124bp	127bp	9%	204.7M	86.3%	57%	124bp	127bp	9%	204.7M
aih-tih-sc-431fe7-R1_A23WJ53LT4_1_trimmed_2																																																		85.8%	57%	124bp	127bp	9%	204.7M	85.8%	57%	124bp	127bp	9%	204.7M
aih-tih-sc-487f7f-R1_A23WJ53LT4_1	9990000000	49621040	363402074	0.9241	377940636	0.01%	0.86%	53891439	0.85%	0.90%	0.11%	0.10%	45595706	22874134	6040477	2671024	66.97	27.00	0.48%	0.19%	0.98	0.000	119.4bp	111.0bp	0.01%	0.85%	0.29%	0.00%	0.01%	2.76%	0.51%	0.00%	0.04	No	0.00%				86.3%	87.2%	95.3%	180.0M	52.2%	97.5%	42588.4Mb	377.9M	57.8%	98.6%	75.9%
aih-tih-sc-487f7f-R1_A23WJ53LT4_1_1																																				119.4bp	98.0%	185.1M												89.6%	55%	151bp	151bp	18%	191.6M
aih-tih-sc-487f7f-R1_A23WJ53LT4_1_2																																																		88.1%	56%	151bp	151bp	18%	191.6M
aih-tih-sc-487f7f-R1_A23WJ53LT4_1_trimmed_1																																																		89.7%	57%	115bp	117bp	9%	189.0M	89.7%	57%	115bp	117bp	9%	189.0M
aih-tih-sc-487f7f-R1_A23WJ53LT4_1_trimmed_2																																																		89.2%	57%	116bp	117bp	9%	189.0M	89.2%	57%	116bp	117bp	9%	189.0M
aih-tih-sc-488877-R1_A23WJ53LT4_1	9999000000	232790426	571563053	0.9118	591693048	0.00%	0.57%	252516434	0.94%	0.96%	0.05%	0.04%	237206928	119804355	12684219	4348385	443.75	225.00	0.76%	0.64%	0.98	0.000	143.4bp	130.0bp	0.00%	1.14%	0.46%	0.00%	0.01%	3.58%	0.69%	0.00%	0.01	No	0.00%				57.6%	89.6%	95.6%	282.8M	39.1%	97.5%	73541.8Mb	591.7M	55.1%	98.6%	57.3%
aih-tih-sc-488877-R1_A23WJ53LT4_1_1																																				143.4bp	98.3%	290.9M												86.1%	53%	151bp	151bp	18%	366.4M
aih-tih-sc-488877-R1_A23WJ53LT4_1_2																																																		84.9%	54%	151bp	151bp	18%	366.4M
aih-tih-sc-488877-R1_A23WJ53LT4_1_trimmed_1																																																		84.6%	54%	127bp	137bp	9%	295.8M	84.6%	54%	127bp	137bp	9%	295.8M
aih-tih-sc-488877-R1_A23WJ53LT4_1_trimmed_2																																																		84.6%	55%	127bp	137bp	9%	295.8M	84.6%	55%	127bp	137bp	9%	295.8M
aih-tih-sc-4c132f-R1_A23WJ53LT4_1	9999000000	165310855	575005455	0.8532	593496906	0.01%	0.66%	204393471	0.93%	0.96%	0.06%	0.04%	189691757	95576533	11593704	4478948	325.81	157.00	0.72%	0.58%	0.98	0.000	130.2bp	120.0bp	0.01%	0.76%	0.35%	0.00%	0.01%	2.56%	0.59%	0.00%	0.04	No	0.00%				65.9%	89.4%	95.8%	284.2M	43.3%	97.5%	71111.7Mb	593.5M	56.4%	98.9%	67.0%
aih-tih-sc-4c132f-R1_A23WJ53LT4_1_1																																				130.2bp	98.4%	292.1M												86.4%	55%	151bp	151bp	27%	341.5M
aih-tih-sc-4c132f-R1_A23WJ53LT4_1_2																																																		85.7%	56%	151bp	151bp	27%	341.5M
aih-tih-sc-4c132f-R1_A23WJ53LT4_1_trimmed_1																																																		85.4%	56%	123bp	127bp	18%	296.7M	85.4%	56%	123bp	127bp	18%	296.7M
aih-tih-sc-4c132f-R1_A23WJ53LT4_1_trimmed_2																																																		85.6%	56%	123bp	127bp	18%	296.7M	85.6%	56%	123bp	127bp	18%	296.7M
aih-tih-sc-4ca6a8-R1_A23WJ53LT4_1	9999000000	241462892	577932858	0.9491	593420276	0.00%	0.59%	242806119	0.94%	0.97%	0.05%	0.03%	228545888	115378033	11358459	3902600	434.70	208.00	0.75%	0.62%	0.97	0.000	141.5bp	130.0bp	0.01%	1.13%	0.41%	0.00%	0.02%	3.77%	0.72%	0.00%	0.01	No	0.00%				59.4%	90.9%	96.3%	285.7M	41.1%	97.4%	74005.0Mb	593.4M	56.3%	98.9%	58.1%
aih-tih-sc-4ca6a8-R1_A23WJ53LT4_1_1																																				141.5bp	98.6%	292.6M												89.2%	55%	151bp	151bp	27%	491.2M
aih-tih-sc-4ca6a8-R1_A23WJ53LT4_1_2																																																		88.0%	55%	151bp	151bp	27%	491.2M
aih-tih-sc-4ca6a8-R1_A23WJ53LT4_1_trimmed_1																																																		86.0%	56%	128bp	137bp	18%	296.7M	86.0%	56%	128bp	137bp	18%	296.7M
aih-tih-sc-4ca6a8-R1_A23WJ53LT4_1_trimmed_2																																																		85.8%	56%	128bp	137bp	18%	296.7M	85.8%	56%	128bp	137bp	18%	296.7M
aih-tih-sc-4d6599-R1_A23WJ53LT4_1	9999000000	255244803	576582828	0.9053	594066556	0.00%	0.56%	261037971	0.94%	0.97%	0.05%	0.03%	246160398	124349821	12017913	4081489	466.26	237.00	0.76%	0.64%	0.98	0.000	142.1bp	130.0bp	0.01%	0.88%	0.48%	0.00%	0.01%	2.88%	0.77%	0.00%	0.02	No	0.00%				56.3%	90.4%	96.1%	285.5M	39.0%	97.6%	74097.8Mb	594.1M	55.6%	99.0%	57.4%
aih-tih-sc-4d6599-R1_A23WJ53LT4_1_1																																				142.1bp	98.5%	292.5M												86.2%	54%	151bp	151bp	18%	384.9M
aih-tih-sc-4d6599-R1_A23WJ53LT4_1_2																																																		85.5%	55%	151bp	151bp	18%	384.9M
aih-tih-sc-4d6599-R1_A23WJ53LT4_1_trimmed_1																																																		84.3%	55%	128bp	137bp	9%	297.0M	84.3%	55%	128bp	137bp	9%	297.0M
aih-tih-sc-4d6599-R1_A23WJ53LT4_1_trimmed_2																																																		84.6%	55%	128bp	137bp	9%	297.0M	84.6%	55%	128bp	137bp	9%	297.0M
aih-tih-sc-4e749e-R1_A23WJ53LT4_1	9999000000	137574530	568264666	0.9347	591366368	0.01%	0.71%	172160757	0.92%	0.96%	0.06%	0.04%	159037725	80341521	9795713	3386446	298.52	107.00	0.68%	0.51%	0.97	0.000	149.1bp	136.0bp	0.00%	0.81%	0.59%	0.00%	0.01%	2.62%	0.96%	0.00%	5.34	No	0.00%				71.3%	88.2%	95.2%	281.6M	51.4%	97.4%	74840.1Mb	591.4M	59.4%	98.6%	53.2%
aih-tih-sc-4e749e-R1_A23WJ53LT4_1_1																																				149.1bp	98.1%	290.0M												90.1%	58%	151bp	151bp	18%	411.4M
aih-tih-sc-4e749e-R1_A23WJ53LT4_1_2																																																		88.8%	58%	151bp	151bp	18%	411.4M
aih-tih-sc-4e749e-R1_A23WJ53LT4_1_trimmed_1																																																		88.2%	59%	130bp	147bp	9%	295.7M	88.2%	59%	130bp	147bp	9%	295.7M
aih-tih-sc-4e749e-R1_A23WJ53LT4_1_trimmed_2																																																		88.1%	59%	130bp	147bp	9%	295.7M	88.1%	59%	130bp	147bp	9%	295.7M
aih-tih-sc-4fd42c-R1_A23WJ53LT4_1	9999000000	325637495	575213162	0.9343	593084804	0.00%	0.50%	294040083	0.95%	0.97%	0.04%	0.03%	279264214	141228248	12174304	3698707	557.10	251.00	0.72%	0.62%	0.98	0.000	151.8bp	137.0bp	0.01%	1.36%	0.72%	0.00%	0.02%	4.02%	1.04%	0.00%	4.17	No	0.00%				50.6%	90.1%	96.1%	285.1M	35.4%	97.5%	75675.3Mb	593.1M	55.7%	98.8%	51.9%
aih-tih-sc-4fd42c-R1_A23WJ53LT4_1_1																																				151.8bp	98.4%	291.9M												88.1%	54%	151bp	151bp	18%	535.5M
aih-tih-sc-4fd42c-R1_A23WJ53LT4_1_2																																																		87.4%	55%	151bp	151bp	18%	535.5M
aih-tih-sc-4fd42c-R1_A23WJ53LT4_1_trimmed_1																																																		84.2%	55%	131bp	147bp	9%	296.5M	84.2%	55%	131bp	147bp	9%	296.5M
aih-tih-sc-4fd42c-R1_A23WJ53LT4_1_trimmed_2																																																		84.6%	55%	131bp	147bp	9%	296.5M	84.6%	55%	131bp	147bp	9%	296.5M
aih-tih-sc-550807-R1_A23WJ53LT4_1	9990000000	160743397	335616011	0.9671	347088058	0.00%	0.53%	161837297	0.94%	0.96%	0.05%	0.04%	152051786	76704595	8069174	2879737	282.65	133.00	0.70%	0.55%	0.98	0.000	144.2bp	132.0bp	0.01%	1.07%	0.52%	0.00%	0.01%	3.40%	0.80%	0.00%	0.00	No	0.00%				53.6%	88.8%	95.8%	166.3M	37.2%	97.5%	43558.5Mb	347.1M	55.5%	98.7%	57.8%
aih-tih-sc-550807-R1_A23WJ53LT4_1_1																																				144.2bp	98.0%	170.0M												80.9%	54%	151bp	151bp	18%	175.8M
aih-tih-sc-550807-R1_A23WJ53LT4_1_2																																																		80.1%	55%	151bp	151bp	18%	175.8M
aih-tih-sc-550807-R1_A23WJ53LT4_1_trimmed_1																																																		80.9%	55%	129bp	137bp	9%	173.5M	80.9%	55%	129bp	137bp	9%	173.5M
aih-tih-sc-550807-R1_A23WJ53LT4_1_trimmed_2																																																		81.2%	55%	129bp	137bp	9%	173.5M	81.2%	55%	129bp	137bp	9%	173.5M
aih-tih-sc-55b175-R1_A23WJ53LT4_1	9999000000	402362884	570401124	0.9390	592566070	0.01%	0.47%	313822775	0.94%	0.97%	0.05%	0.03%	294285466	149346615	15230309	4451820	617.58	288.00	0.74%	0.64%	0.97	0.000	167.6bp	151.0bp	0.01%	0.85%	0.48%	0.00%	0.01%	2.57%	0.72%	0.00%	6.22	No	0.00%				47.4%	89.1%	95.4%	282.5M	34.6%	97.3%	77732.2Mb	592.6M	54.8%	98.8%	43.6%
aih-tih-sc-55b175-R1_A23WJ53LT4_1_1																																				167.6bp	97.4%	288.7M												87.1%	54%	151bp	151bp	18%	406.7M
aih-tih-sc-55b175-R1_A23WJ53LT4_1_2																																																		86.0%	54%	151bp	151bp	18%	406.7M
aih-tih-sc-55b175-R1_A23WJ53LT4_1_trimmed_1																																																		85.1%	54%	135bp	151bp	18%	296.3M	85.1%	54%	135bp	151bp	18%	296.3M
aih-tih-sc-55b175-R1_A23WJ53LT4_1_trimmed_2																																																		85.0%	55%	135bp	151bp	9%	296.3M	85.0%	55%	135bp	151bp	9%	296.3M
aih-tih-sc-560d56-R1_A23WJ53LT4_1	9999000000	54123271	355366745	0.9077	368977390	0.01%	0.84%	59717405	0.86%	0.91%	0.10%	0.09%	51585298	25947712	5754127	2481296	80.76	37.00	0.55%	0.25%	0.98	0.000	127.9bp	119.0bp	0.01%	0.63%	0.29%	0.00%	0.01%	2.17%	0.49%	0.00%	0.01	No	0.00%				84.4%	87.5%	95.4%	176.0M	58.2%	97.5%	43469.8Mb	369.0M	57.2%	98.9%	70.4%
aih-tih-sc-560d56-R1_A23WJ53LT4_1_1																																				127.9bp	98.0%	180.8M												88.5%	55%	151bp	151bp	18%	186.6M
aih-tih-sc-560d56-R1_A23WJ53LT4_1_2																																																		87.4%	56%	151bp	151bp	18%	186.6M
aih-tih-sc-560d56-R1_A23WJ53LT4_1_trimmed_1																																																		88.6%	56%	121bp	122bp	9%	184.5M	88.6%	56%	121bp	122bp	9%	184.5M
aih-tih-sc-560d56-R1_A23WJ53LT4_1_trimmed_2																																																		88.3%	57%	121bp	122bp	9%	184.5M	88.3%	57%	121bp	122bp	9%	184.5M
aih-tih-sc-58b830-R1_A23WJ53LT4_1	9999000000	63630025	426690629	0.9164	443035964	0.01%	0.84%	69256845	0.85%	0.89%	0.11%	0.11%	58802008	29514006	7832471	3521538	87.04	37.00	0.54%	0.25%	0.98	0.000	118.8bp	113.0bp	0.02%	1.06%	0.43%	0.00%	0.04%	3.30%	0.69%	0.00%	0.02	No	0.00%				84.9%	87.2%	95.2%	210.8M	54.2%	97.6%	50370.8Mb	443.0M	55.2%	98.9%	77.6%
aih-tih-sc-58b830-R1_A23WJ53LT4_1_1																																				118.8bp	97.9%	216.9M												88.9%	54%	151bp	151bp	18%	224.0M
aih-tih-sc-58b830-R1_A23WJ53LT4_1_2																																																		87.9%	54%	151bp	151bp	18%	224.0M
aih-tih-sc-58b830-R1_A23WJ53LT4_1_trimmed_1																																																		89.0%	55%	116bp	117bp	9%	221.5M	89.0%	55%	116bp	117bp	9%	221.5M
aih-tih-sc-58b830-R1_A23WJ53LT4_1_trimmed_2																																																		88.7%	55%	117bp	117bp	9%	221.5M	88.7%	55%	117bp	117bp	9%	221.5M
aih-tih-sc-5d3207-R1_A23WJ53LT4_1	9999000000	210725345	311894315	0.9408	321393950	0.01%	0.46%	173339795	0.94%	0.97%	0.05%	0.03%	163306310	82579095	8346035	2761465	318.88	163.00	0.73%	0.59%	0.98	0.000	153.5bp	138.0bp	0.01%	0.77%	0.39%	0.00%	0.02%	2.60%	0.63%	0.00%	0.01	No	0.00%				46.3%	90.5%	96.1%	154.4M	30.8%	97.6%	40797.7Mb	321.4M	55.1%	98.8%	52.3%
aih-tih-sc-5d3207-R1_A23WJ53LT4_1_1																																				153.5bp	98.1%	157.7M												80.0%	54%	151bp	151bp	18%	162.7M
aih-tih-sc-5d3207-R1_A23WJ53LT4_1_2																																																		79.1%	55%	151bp	151bp	18%	162.7M
aih-tih-sc-5d3207-R1_A23WJ53LT4_1_trimmed_1																																																		80.0%	54%	130bp	147bp	9%	160.7M	80.0%	54%	130bp	147bp	9%	160.7M
aih-tih-sc-5d3207-R1_A23WJ53LT4_1_trimmed_2																																																		80.1%	55%	130bp	147bp	9%	160.7M	80.1%	55%	130bp	147bp	9%	160.7M
aih-tih-sc-5e5452-R1_A23WJ53LT4_1	9990000000	53163143	259860547	0.9338	269106434	0.01%	0.78%	60002081	0.89%	0.93%	0.08%	0.07%	53377954	26770112	4922359	2157710	75.73	31.00	0.51%	0.22%	0.98	0.000	111.3bp	104.0bp	0.01%	0.78%	0.35%	0.00%	0.01%	2.50%	0.56%	0.00%	0.06	No	0.00%				78.2%	88.1%	95.4%	128.3M	43.8%	97.5%	29143.1Mb	269.1M	56.1%	98.7%	81.6%
aih-tih-sc-5e5452-R1_A23WJ53LT4_1_1																																				111.3bp	97.9%	131.8M												84.1%	54%	151bp	151bp	18%	136.3M
aih-tih-sc-5e5452-R1_A23WJ53LT4_1_2																																																		82.9%	55%	151bp	151bp	27%	136.3M
aih-tih-sc-5e5452-R1_A23WJ53LT4_1_trimmed_1																																																		84.1%	55%	111bp	112bp	9%	134.6M	84.1%	55%	111bp	112bp	9%	134.6M
aih-tih-sc-5e5452-R1_A23WJ53LT4_1_trimmed_2																																																		83.7%	56%	111bp	112bp	9%	134.6M	83.7%	56%	111bp	112bp	9%	134.6M
aih-tih-sc-606237-R1_A23WJ53LT4_1	9999000000	406927702	573197546	0.9615	591932916	0.00%	0.46%	316897562	0.95%	0.98%	0.04%	0.02%	300338417	152263555	13920289	3854527	631.85	258.00	0.71%	0.62%	0.97	0.000	164.6bp	146.0bp	0.02%	1.71%	0.69%	0.00%	0.03%	4.94%	1.00%	0.00%	0.00	No	0.00%				46.7%	90.0%	96.1%	284.3M	33.5%	97.4%	76912.3Mb	591.9M	54.8%	98.7%	44.6%
aih-tih-sc-606237-R1_A23WJ53LT4_1_1																																				164.6bp	98.2%	290.6M												87.5%	54%	151bp	151bp	18%	471.9M
aih-tih-sc-606237-R1_A23WJ53LT4_1_2																																																		86.5%	54%	151bp	151bp	18%	471.9M
aih-tih-sc-606237-R1_A23WJ53LT4_1_trimmed_1																																																		84.6%	54%	133bp	151bp	9%	296.0M	84.6%	54%	133bp	151bp	9%	296.0M
aih-tih-sc-606237-R1_A23WJ53LT4_1_trimmed_2																																																		84.9%	55%	133bp	151bp	9%	296.0M	84.9%	55%	133bp	151bp	9%	296.0M
aih-tih-sc-6064dc-R1_A23WJ53LT4_1	9999000000	60920370	324995799	0.9529	336085022	0.01%	0.80%	67420533	0.90%	0.95%	0.07%	0.05%	60844627	30825624	4835335	1676594	116.46	43.00	0.56%	0.32%	0.98	0.000	159.5bp	144.0bp	0.07%	1.05%	0.66%	0.00%	0.14%	3.14%	0.93%	0.00%	0.13	No	0.00%				80.4%	88.4%	95.8%	161.1M	61.2%	97.5%	43557.2Mb	336.1M	55.8%	98.7%	48.3%
aih-tih-sc-6064dc-R1_A23WJ53LT4_1_1																																				159.5bp	97.9%	164.5M												88.9%	54%	151bp	151bp	18%	170.2M
aih-tih-sc-6064dc-R1_A23WJ53LT4_1_2																																																		87.4%	55%	151bp	151bp	18%	170.2M
aih-tih-sc-6064dc-R1_A23WJ53LT4_1_trimmed_1																																																		89.0%	55%	133bp	151bp	9%	168.0M	89.0%	55%	133bp	151bp	9%	168.0M
aih-tih-sc-6064dc-R1_A23WJ53LT4_1_trimmed_2																																																		88.4%	56%	133bp	151bp	9%	168.0M	88.4%	56%	133bp	151bp	9%	168.0M
aih-tih-sc-64cace-R1_A23WJ53LT4_1	9999000000	244259800	154060880	0.9586	158396196	0.00%	0.28%	113703552	0.95%	0.97%	0.04%	0.03%	107876949	54635087	5076687	1558253	220.80	110.00	0.69%	0.52%	0.98	0.000	161.0bp	145.0bp	0.01%	0.97%	0.47%	0.00%	0.02%	3.08%	0.71%	0.00%	0.00	No	0.00%				28.3%	91.0%	96.3%	76.3M	20.3%	97.5%	20551.9Mb	158.4M	55.0%	98.8%	47.2%
aih-tih-sc-64cace-R1_A23WJ53LT4_1_1																																				161.0bp	98.0%	77.6M												71.6%	54%	151bp	151bp	18%	80.1M
aih-tih-sc-64cace-R1_A23WJ53LT4_1_2																																																		70.7%	55%	151bp	151bp	18%	80.1M
aih-tih-sc-64cace-R1_A23WJ53LT4_1_trimmed_1																																																		71.6%	54%	133bp	151bp	9%	79.2M	71.6%	54%	133bp	151bp	9%	79.2M
aih-tih-sc-64cace-R1_A23WJ53LT4_1_trimmed_2																																																		71.5%	55%	133bp	151bp	9%	79.2M	71.5%	55%	133bp	151bp	9%	79.2M
aih-tih-sc-669302-R1_A23WJ53LT4_1	9999000000	231933106	566047908	0.9536	592327220	0.00%	0.57%	253032320	0.94%	0.97%	0.05%	0.03%	236852942	120014618	13508019	4309897	479.97	194.00	0.70%	0.59%	0.98	0.000	160.2bp	144.0bp	0.01%	1.20%	0.54%	0.00%	0.03%	3.70%	0.83%	0.00%	4.56	No	0.00%				57.5%	86.8%	94.9%	281.0M	41.1%	97.6%	76469.7Mb	592.3M	55.2%	98.7%	47.1%
aih-tih-sc-669302-R1_A23WJ53LT4_1_1																																				160.2bp	97.9%	289.8M												86.3%	54%	151bp	151bp	18%	364.4M
aih-tih-sc-669302-R1_A23WJ53LT4_1_2																																																		85.6%	55%	151bp	151bp	18%	364.4M
aih-tih-sc-669302-R1_A23WJ53LT4_1_trimmed_1																																																		84.8%	54%	132bp	151bp	9%	296.2M	84.8%	54%	132bp	151bp	9%	296.2M
aih-tih-sc-669302-R1_A23WJ53LT4_1_trimmed_2																																																		85.2%	55%	132bp	151bp	9%	296.2M	85.2%	55%	132bp	151bp	9%	296.2M
aih-tih-sc-66e7f5-R1_A23WJ53LT4_1	9999000000	94338577	402355367	0.9302	418596516	0.01%	0.75%	103254748	0.88%	0.92%	0.10%	0.08%	90871523	45762537	9833608	4220025	149.87	67.00	0.63%	0.41%	0.98	0.000	131.8bp	122.0bp	0.01%	1.09%	0.34%	0.00%	0.03%	3.39%	0.56%	0.00%	0.03	No	0.00%				75.8%	87.6%	95.2%	199.3M	49.9%	97.5%	49888.5Mb	418.6M	56.0%	98.8%	67.7%
aih-tih-sc-66e7f5-R1_A23WJ53LT4_1_1																																				131.8bp	97.5%	204.1M												86.5%	54%	151bp	151bp	18%	211.8M
aih-tih-sc-66e7f5-R1_A23WJ53LT4_1_2																																																		85.5%	55%	151bp	151bp	18%	211.8M
aih-tih-sc-66e7f5-R1_A23WJ53LT4_1_trimmed_1																																																		86.6%	55%	122bp	127bp	9%	209.3M	86.6%	55%	122bp	127bp	9%	209.3M
aih-tih-sc-66e7f5-R1_A23WJ53LT4_1_trimmed_2																																																		86.4%	56%	122bp	127bp	9%	209.3M	86.4%	56%	122bp	127bp	9%	209.3M
aih-tih-sc-6734d6-R1_A23WJ53LT4_1	9999000000	201256998	573542014	0.9540	592713622	0.00%	0.60%	235684682	0.94%	0.97%	0.05%	0.03%	221030236	111732393	11809022	3939088	426.48	180.00	0.73%	0.60%	0.98	0.000	150.8bp	137.0bp	0.02%	0.69%	0.46%	0.00%	0.04%	2.20%	0.73%	0.00%	0.01	No	0.00%				60.5%	89.2%	95.8%	284.1M	44.0%	97.4%	75441.1Mb	592.7M	58.1%	98.8%	53.2%
aih-tih-sc-6734d6-R1_A23WJ53LT4_1_1																																				150.8bp	98.3%	291.4M												87.9%	57%	151bp	151bp	18%	366.1M
aih-tih-sc-6734d6-R1_A23WJ53LT4_1_2																																																		86.9%	57%	151bp	151bp	18%	366.1M
aih-tih-sc-6734d6-R1_A23WJ53LT4_1_trimmed_1																																																		86.6%	57%	131bp	147bp	9%	296.4M	86.6%	57%	131bp	147bp	9%	296.4M
aih-tih-sc-6734d6-R1_A23WJ53LT4_1_trimmed_2																																																		86.6%	58%	131bp	147bp	9%	296.4M	86.6%	58%	131bp	147bp	9%	296.4M
aih-tih-sc-674b78-R1_A23WJ53LT4_1	9999000000	219268216	556594832	0.9243	592452014	0.01%	0.59%	243572618	0.93%	0.96%	0.05%	0.04%	227329808	114954077	12411592	4195798	418.70	171.00	0.71%	0.59%	0.98	0.000	142.2bp	130.0bp	0.02%	0.98%	0.53%	0.00%	0.03%	2.86%	0.80%	0.00%	5.25	No	0.00%				59.3%	82.6%	93.1%	275.8M	39.6%	97.4%	73235.1Mb	592.5M	58.0%	98.7%	58.9%
aih-tih-sc-674b78-R1_A23WJ53LT4_1_1																																				142.2bp	98.1%	290.6M												86.9%	56%	151bp	151bp	18%	380.5M
aih-tih-sc-674b78-R1_A23WJ53LT4_1_2																																																		86.0%	57%	151bp	151bp	18%	380.5M
aih-tih-sc-674b78-R1_A23WJ53LT4_1_trimmed_1																																																		85.1%	57%	127bp	137bp	9%	296.2M	85.1%	57%	127bp	137bp	9%	296.2M
aih-tih-sc-674b78-R1_A23WJ53LT4_1_trimmed_2																																																		85.3%	58%	127bp	137bp	9%	296.2M	85.3%	58%	127bp	137bp	9%	296.2M
aih-tih-sc-6832bb-R1_A23WJ53LT4_1	9999000000	225704722	576892729	0.9547	592465708	0.00%	0.58%	246960346	0.95%	0.97%	0.04%	0.03%	233449724	117706934	10961771	3793589	420.25	204.00	0.75%	0.62%	0.98	0.000	135.5bp	124.0bp	0.01%	1.13%	0.50%	0.00%	0.01%	3.43%	0.76%	0.00%	0.00	No	0.00%				58.6%	91.1%	96.3%	285.2M	39.0%	97.7%	71807.7Mb	592.5M	54.2%	98.7%	63.4%
aih-tih-sc-6832bb-R1_A23WJ53LT4_1_1																																				135.5bp	98.6%	292.2M												86.1%	53%	151bp	151bp	18%	307.4M
aih-tih-sc-6832bb-R1_A23WJ53LT4_1_2																																																		85.1%	53%	151bp	151bp	18%	307.4M
aih-tih-sc-6832bb-R1_A23WJ53LT4_1_trimmed_1																																																		85.9%	53%	124bp	132bp	9%	296.2M	85.9%	53%	124bp	132bp	9%	296.2M
aih-tih-sc-6832bb-R1_A23WJ53LT4_1_trimmed_2																																																		86.0%	54%	124bp	132bp	9%	296.2M	86.0%	54%	124bp	132bp	9%	296.2M
aih-tih-sc-693ffe-R1_A23WJ53LT4_1	9999000000	99302463	557062515	0.8729	575289474	0.01%	0.80%	113429342	0.88%	0.92%	0.09%	0.08%	99906642	50344830	10135618	4221317	162.65	68.00	0.63%	0.42%	0.98	0.000	129.5bp	120.0bp	0.01%	0.60%	0.41%	0.00%	0.01%	2.02%	0.68%	0.00%	0.01	No	0.00%				80.8%	88.1%	95.8%	275.5M	55.9%	97.5%	68734.3Mb	575.3M	57.0%	99.0%	68.4%
aih-tih-sc-693ffe-R1_A23WJ53LT4_1_1																																				129.5bp	98.1%	282.2M												89.0%	55%	151bp	151bp	18%	290.7M
aih-tih-sc-693ffe-R1_A23WJ53LT4_1_2																																																		87.7%	56%	151bp	151bp	18%	290.7M
aih-tih-sc-693ffe-R1_A23WJ53LT4_1_trimmed_1																																																		89.1%	56%	122bp	127bp	9%	287.6M	89.1%	56%	122bp	127bp	9%	287.6M
aih-tih-sc-693ffe-R1_A23WJ53LT4_1_trimmed_2																																																		88.5%	57%	123bp	127bp	9%	287.6M	88.5%	57%	123bp	127bp	9%	287.6M
aih-tih-sc-6f889c-R1_A23WJ53LT4_1	9999000000	73837191	252650479	0.9411	262610462	0.01%	0.71%	75561077	0.90%	0.94%	0.07%	0.06%	68364992	34380901	5498025	2299497	111.97	52.00	0.60%	0.34%	0.98	0.000	129.3bp	121.0bp	0.01%	0.73%	0.32%	0.00%	0.01%	2.50%	0.54%	0.00%	0.01	No	0.00%				71.7%	87.2%	95.2%	125.0M	49.0%	97.6%	31460.0Mb	262.6M	56.5%	98.8%	68.6%
aih-tih-sc-6f889c-R1_A23WJ53LT4_1_1																																				129.3bp	98.1%	128.8M												83.7%	55%	151bp	151bp	18%	132.9M
aih-tih-sc-6f889c-R1_A23WJ53LT4_1_2																																																		82.5%	55%	151bp	151bp	18%	132.9M
aih-tih-sc-6f889c-R1_A23WJ53LT4_1_trimmed_1																																																		83.8%	56%	123bp	127bp	9%	131.3M	83.8%	56%	123bp	127bp	9%	131.3M
aih-tih-sc-6f889c-R1_A23WJ53LT4_1_trimmed_2																																																		83.5%	56%	123bp	127bp	9%	131.3M	83.5%	56%	123bp	127bp	9%	131.3M
aih-tih-sc-6fcd81-R1_A23WJ53LT4_1	9999000000	184364428	568835762	0.8987	593070554	0.01%	0.63%	219245783	0.93%	0.96%	0.05%	0.04%	203350458	102786105	11101574	3762851	380.11	179.00	0.74%	0.60%	0.98	0.000	144.8bp	132.0bp	0.00%	0.86%	0.45%	0.00%	0.01%	2.52%	0.68%	0.00%	0.00	No	0.00%				63.5%	86.9%	94.9%	281.5M	44.4%	97.5%	74232.4Mb	593.1M	56.4%	98.8%	57.0%
aih-tih-sc-6fcd81-R1_A23WJ53LT4_1_1																																				144.8bp	98.0%	290.5M												88.1%	55%	151bp	151bp	18%	440.3M
aih-tih-sc-6fcd81-R1_A23WJ53LT4_1_2																																																		86.9%	56%	151bp	151bp	18%	440.3M
aih-tih-sc-6fcd81-R1_A23WJ53LT4_1_trimmed_1																																																		85.3%	56%	128bp	142bp	9%	296.5M	85.3%	56%	128bp	142bp	9%	296.5M
aih-tih-sc-6fcd81-R1_A23WJ53LT4_1_trimmed_2																																																		85.1%	56%	128bp	142bp	9%	296.5M	85.1%	56%	128bp	142bp	9%	296.5M
aih-tih-sc-6ff823-R1_A23WJ53LT4_1	9999000000	112687145	525412470	0.8832	541922214	0.00%	0.72%	151064131	0.92%	0.95%	0.06%	0.05%	139517557	70140985	8873278	3608216	222.52	105.00	0.68%	0.51%	0.98	0.000	123.9bp	116.0bp	0.00%	1.13%	0.69%	0.00%	0.01%	3.67%	1.10%	0.00%	0.01	No	0.00%				72.5%	89.1%	95.8%	259.6M	46.4%	97.7%	63116.5Mb	541.9M	55.0%	99.0%	73.7%
aih-tih-sc-6ff823-R1_A23WJ53LT4_1_1																																				123.9bp	98.5%	266.9M												85.3%	54%	151bp	151bp	18%	273.8M
aih-tih-sc-6ff823-R1_A23WJ53LT4_1_2																																																		84.5%	54%	151bp	151bp	27%	273.8M
aih-tih-sc-6ff823-R1_A23WJ53LT4_1_trimmed_1																																																		85.4%	54%	119bp	122bp	9%	271.0M	85.4%	54%	119bp	122bp	9%	271.0M
aih-tih-sc-6ff823-R1_A23WJ53LT4_1_trimmed_2																																																		85.4%	55%	119bp	122bp	9%	271.0M	85.4%	55%	119bp	122bp	9%	271.0M
aih-tih-sc-7cc8a0-R1_A23WJ53LT4_1	9999000000	266250670	577805084	0.8837	593208500	0.00%	0.57%	255523407	0.94%	0.97%	0.05%	0.03%	240335882	121624015	12337522	4015527	471.83	220.00	0.73%	0.62%	0.98	0.000	148.2bp	134.0bp	0.01%	0.73%	0.42%	0.00%	0.02%	2.62%	0.72%	0.00%	0.00	No	0.00%				57.2%	91.2%	96.5%	286.4M	39.0%	97.5%	75142.4Mb	593.2M	57.0%	98.9%	53.0%
aih-tih-sc-7cc8a0-R1_A23WJ53LT4_1_1																																				148.2bp	98.3%	291.6M												87.5%	55%	151bp	151bp	18%	452.7M
aih-tih-sc-7cc8a0-R1_A23WJ53LT4_1_2																																																		86.6%	56%	151bp	151bp	18%	452.7M
aih-tih-sc-7cc8a0-R1_A23WJ53LT4_1_trimmed_1																																																		84.6%	56%	130bp	147bp	18%	296.6M	84.6%	56%	130bp	147bp	18%	296.6M
aih-tih-sc-7cc8a0-R1_A23WJ53LT4_1_trimmed_2																																																		84.7%	57%	130bp	147bp	9%	296.6M	84.7%	57%	130bp	147bp	9%	296.6M
aih-tih-sc-7d33b9-R1_A23WJ53LT4_1	9999000000	295668629	575271034	0.9172	593978402	0.01%	0.52%	283771037	0.93%	0.96%	0.06%	0.04%	264281038	133739749	16339489	5870864	505.22	233.00	0.74%	0.62%	0.98	0.000	147.2bp	134.0bp	0.01%	0.67%	0.51%	0.00%	0.03%	2.05%	0.74%	0.00%	0.01	No	0.00%				52.5%	90.0%	96.0%	285.1M	36.0%	97.6%	74899.3Mb	594.0M	54.9%	99.0%	55.2%
aih-tih-sc-7d33b9-R1_A23WJ53LT4_1_1																																				147.2bp	97.8%	290.6M												84.2%	53%	151bp	151bp	18%	326.4M
aih-tih-sc-7d33b9-R1_A23WJ53LT4_1_2																																																		83.6%	54%	151bp	151bp	18%	326.4M
aih-tih-sc-7d33b9-R1_A23WJ53LT4_1_trimmed_1																																																		83.6%	54%	129bp	142bp	9%	297.0M	83.6%	54%	129bp	142bp	9%	297.0M
aih-tih-sc-7d33b9-R1_A23WJ53LT4_1_trimmed_2																																																		83.7%	55%	129bp	142bp	9%	297.0M	83.7%	55%	129bp	142bp	9%	297.0M
aih-tih-sc-7de750-R1_A23WJ53LT4_1	9999000000	144720744	570339156	0.9216	592969314	0.01%	0.69%	183332525	0.93%	0.96%	0.05%	0.04%	169745537	85646275	10049433	3657990	300.49	138.00	0.70%	0.56%	0.98	0.000	136.3bp	124.0bp	0.01%	0.90%	0.50%	0.00%	0.03%	2.81%	0.80%	0.00%	0.01	No	0.00%				69.5%	88.2%	95.3%	282.6M	46.7%	97.5%	72197.8Mb	593.0M	57.6%	98.8%	62.1%
aih-tih-sc-7de750-R1_A23WJ53LT4_1_1																																				136.3bp	98.1%	290.8M												86.6%	55%	151bp	151bp	18%	323.2M
aih-tih-sc-7de750-R1_A23WJ53LT4_1_2																																																		85.5%	57%	151bp	151bp	18%	323.2M
aih-tih-sc-7de750-R1_A23WJ53LT4_1_trimmed_1																																																		86.0%	57%	125bp	132bp	9%	296.5M	86.0%	57%	125bp	132bp	9%	296.5M
aih-tih-sc-7de750-R1_A23WJ53LT4_1_trimmed_2																																																		85.9%	57%	125bp	132bp	9%	296.5M	85.9%	57%	125bp	132bp	9%	296.5M
aih-tih-sc-804b22-R1_A23WJ53LT4_1	9999000000	166386982	533510732	0.9426	547657368	0.01%	0.65%	193732487	0.93%	0.96%	0.06%	0.04%	180123041	91119206	10827924	3745711	346.66	172.00	0.74%	0.60%	0.98	0.000	147.8bp	135.0bp	0.01%	0.79%	0.36%	0.00%	0.01%	2.74%	0.61%	0.00%	0.01	No	0.00%				65.0%	91.2%	96.4%	264.0M	46.5%	97.5%	69643.9Mb	547.7M	57.2%	98.9%	53.5%
aih-tih-sc-804b22-R1_A23WJ53LT4_1_1																																				147.8bp	98.3%	269.1M												86.4%	55%	151bp	151bp	27%	276.7M
aih-tih-sc-804b22-R1_A23WJ53LT4_1_2																																																		85.3%	57%	151bp	151bp	27%	276.7M
aih-tih-sc-804b22-R1_A23WJ53LT4_1_trimmed_1																																																		86.5%	56%	130bp	147bp	18%	273.8M	86.5%	56%	130bp	147bp	18%	273.8M
aih-tih-sc-804b22-R1_A23WJ53LT4_1_trimmed_2																																																		86.1%	57%	130bp	147bp	18%	273.8M	86.1%	57%	130bp	147bp	18%	273.8M
aih-tih-sc-8353c5-R1_A23WJ53LT4_1	9999000000	253953650	472831749	0.9332	488549164	0.00%	0.51%	240392612	0.94%	0.96%	0.05%	0.04%	225844962	114267146	12233886	4168676	440.60	213.00	0.73%	0.62%	0.98	0.000	150.8bp	138.0bp	0.01%	1.06%	0.50%	0.00%	0.02%	3.15%	0.74%	0.00%	0.00	No	0.00%				51.0%	89.6%	95.9%	234.3M	36.3%	97.7%	62321.7Mb	488.5M	55.0%	99.0%	52.6%
aih-tih-sc-8353c5-R1_A23WJ53LT4_1_1																																				150.8bp	97.9%	239.2M												83.5%	54%	151bp	151bp	18%	246.8M
aih-tih-sc-8353c5-R1_A23WJ53LT4_1_2																																																		82.6%	54%	151bp	151bp	18%	246.8M
aih-tih-sc-8353c5-R1_A23WJ53LT4_1_trimmed_1																																																		83.5%	54%	131bp	147bp	9%	244.3M	83.5%	54%	131bp	147bp	9%	244.3M
aih-tih-sc-8353c5-R1_A23WJ53LT4_1_trimmed_2																																																		83.5%	55%	131bp	147bp	9%	244.3M	83.5%	55%	131bp	147bp	9%	244.3M
aih-tih-sc-835699-R1_A23WJ53LT4_1	9990000000	233752573	568254764	0.9177	593519136	0.01%	0.58%	246869342	0.94%	0.97%	0.05%	0.03%	232033190	117198139	11118613	3715326	447.33	205.00	0.74%	0.62%	0.98	0.000	147.5bp	134.0bp	0.00%	0.82%	0.55%	0.00%	0.01%	2.71%	0.87%	0.00%	0.00	No	0.00%				58.8%	87.8%	94.8%	281.4M	40.3%	97.5%	74302.7Mb	593.5M	57.2%	98.9%	56.0%
aih-tih-sc-835699-R1_A23WJ53LT4_1_1																																				147.5bp	98.4%	292.1M												88.0%	55%	151bp	151bp	18%	426.6M
aih-tih-sc-835699-R1_A23WJ53LT4_1_2																																																		87.0%	56%	151bp	151bp	18%	426.6M
aih-tih-sc-835699-R1_A23WJ53LT4_1_trimmed_1																																																		85.6%	57%	128bp	142bp	9%	296.8M	85.6%	57%	128bp	142bp	9%	296.8M
aih-tih-sc-835699-R1_A23WJ53LT4_1_trimmed_2																																																		85.6%	57%	128bp	142bp	9%	296.8M	85.6%	57%	128bp	142bp	9%	296.8M
aih-tih-sc-87d1a3-R1_A23WJ53LT4_1	9999000000	296251179	570391987	0.9347	593590784	0.00%	0.52%	282983136	0.94%	0.97%	0.05%	0.03%	266834490	134542466	13366287	4833053	476.36	220.00	0.74%	0.62%	0.98	0.000	135.0bp	124.0bp	0.01%	1.29%	0.52%	0.00%	0.02%	3.73%	0.74%	0.00%	0.01	No	0.00%				52.6%	86.9%	95.0%	282.1M	33.9%	97.7%	71492.5Mb	593.6M	53.7%	98.9%	64.8%
aih-tih-sc-87d1a3-R1_A23WJ53LT4_1_1																																				135.0bp	98.4%	292.0M												84.4%	52%	151bp	151bp	18%	314.4M
aih-tih-sc-87d1a3-R1_A23WJ53LT4_1_2																																																		83.4%	53%	151bp	151bp	18%	314.4M
aih-tih-sc-87d1a3-R1_A23WJ53LT4_1_trimmed_1																																																		84.1%	53%	123bp	127bp	9%	296.8M	84.1%	53%	123bp	127bp	9%	296.8M
aih-tih-sc-87d1a3-R1_A23WJ53LT4_1_trimmed_2																																																		83.9%	53%	123bp	127bp	9%	296.8M	83.9%	53%	123bp	127bp	9%	296.8M
aih-tih-sc-951f98-R1_A23WJ53LT4_1	9999000000	187286478	570368191	0.9651	592412882	0.01%	0.64%	215213736	0.92%	0.95%	0.06%	0.05%	198035067	100117130	13337774	4875431	372.21	187.00	0.73%	0.60%	0.98	0.000	147.4bp	135.0bp	0.01%	1.27%	0.46%	0.00%	0.02%	3.92%	0.72%	0.00%	0.02	No	0.00%				64.1%	88.9%	95.4%	282.6M	45.3%	97.5%	74909.4Mb	592.4M	54.9%	98.7%	55.4%
aih-tih-sc-951f98-R1_A23WJ53LT4_1_1																																				147.4bp	97.6%	289.0M												87.0%	54%	151bp	151bp	18%	347.9M
aih-tih-sc-951f98-R1_A23WJ53LT4_1_2																																																		85.8%	55%	151bp	151bp	18%	347.9M
aih-tih-sc-951f98-R1_A23WJ53LT4_1_trimmed_1																																																		86.0%	54%	130bp	142bp	9%	296.2M	86.0%	54%	130bp	142bp	9%	296.2M
aih-tih-sc-951f98-R1_A23WJ53LT4_1_trimmed_2																																																		85.8%	55%	130bp	142bp	9%	296.2M	85.8%	55%	130bp	142bp	9%	296.2M
aih-tih-sc-965752-R1_A23WJ53LT4_1	9999000000	282034130	574564160	0.9028	593454560	0.01%	0.59%	243234237	0.94%	0.96%	0.05%	0.04%	228477222	115177487	11530905	4182741	398.03	177.00	0.71%	0.59%	0.97	0.000	131.2bp	121.0bp	0.01%	0.91%	0.58%	0.00%	0.01%	2.77%	0.89%	0.00%	0.00	No	0.00%				59.3%	89.4%	95.9%	284.5M	36.0%	97.3%	70507.0Mb	593.5M	56.5%	98.9%	67.2%
aih-tih-sc-965752-R1_A23WJ53LT4_1_1																																				131.2bp	98.4%	292.0M												85.9%	55%	151bp	151bp	18%	427.7M
aih-tih-sc-965752-R1_A23WJ53LT4_1_2																																																		85.0%	56%	151bp	151bp	18%	427.7M
aih-tih-sc-965752-R1_A23WJ53LT4_1_trimmed_1																																																		83.1%	56%	122bp	127bp	9%	296.7M	83.1%	56%	122bp	127bp	9%	296.7M
aih-tih-sc-965752-R1_A23WJ53LT4_1_trimmed_2																																																		83.1%	56%	122bp	127bp	9%	296.7M	83.1%	56%	122bp	127bp	9%	296.7M
aih-tih-sc-96af5b-R1_A23WJ53LT4_1	9999000000	228847772	566401789	0.9607	592998434	0.01%	0.58%	248919689	0.94%	0.97%	0.05%	0.03%	233930264	117919524	11707547	4265582	417.82	181.00	0.70%	0.59%	0.98	0.000	134.2bp	124.0bp	0.03%	1.65%	0.68%	0.00%	0.05%	4.76%	1.03%	0.00%	5.84	Yes	0.00%				58.3%	86.8%	94.6%	280.4M	38.0%	97.6%	71838.4Mb	593.0M	54.9%	98.8%	64.6%
aih-tih-sc-96af5b-R1_A23WJ53LT4_1_1																																				134.2bp	98.4%	291.6M												87.2%	53%	151bp	151bp	18%	410.9M
aih-tih-sc-96af5b-R1_A23WJ53LT4_1_2																																																		86.1%	54%	151bp	151bp	18%	410.9M
aih-tih-sc-96af5b-R1_A23WJ53LT4_1_trimmed_1																																																		85.0%	54%	124bp	132bp	9%	296.5M	85.0%	54%	124bp	132bp	9%	296.5M
aih-tih-sc-96af5b-R1_A23WJ53LT4_1_trimmed_2																																																		84.9%	55%	124bp	132bp	9%	296.5M	84.9%	55%	124bp	132bp	9%	296.5M
aih-tih-sc-98fc22-R1_A23WJ53LT4_1	9999000000	207831853	569431792	0.9419	593344254	0.01%	0.60%	240002588	0.94%	0.97%	0.05%	0.03%	225217321	113585036	11480304	4118464	397.78	186.00	0.71%	0.59%	0.98	0.000	133.9bp	123.0bp	0.01%	0.96%	0.52%	0.00%	0.02%	2.79%	0.78%	0.00%	0.01	Yes	0.27%				59.9%	87.8%	95.1%	282.3M	38.7%	97.6%	71613.7Mb	593.3M	55.6%	98.9%	64.6%
aih-tih-sc-98fc22-R1_A23WJ53LT4_1_1																																				133.9bp	98.3%	291.6M												86.9%	54%	151bp	151bp	18%	417.2M
aih-tih-sc-98fc22-R1_A23WJ53LT4_1_2																																																		86.1%	55%	151bp	151bp	18%	417.2M
aih-tih-sc-98fc22-R1_A23WJ53LT4_1_trimmed_1																																																		84.4%	55%	124bp	127bp	9%	296.7M	84.4%	55%	124bp	127bp	9%	296.7M
aih-tih-sc-98fc22-R1_A23WJ53LT4_1_trimmed_2																																																		84.5%	55%	124bp	132bp	9%	296.7M	84.5%	55%	124bp	132bp	9%	296.7M
aih-tih-sc-9ab390-R1_A23WJ53LT4_1	9999000000	113698121	509003327	0.9137	526419428	0.01%	0.74%	136274980	0.91%	0.94%	0.07%	0.06%	123799976	62452411	9549130	3758378	213.78	99.00	0.67%	0.50%	0.98	0.000	137.5bp	127.0bp	0.02%	0.78%	0.49%	0.00%	0.03%	2.41%	0.74%	0.00%	0.01	No	0.00%				74.5%	89.5%	95.7%	251.8M	53.4%	97.6%	64718.0Mb	526.4M	55.8%	98.9%	62.8%
aih-tih-sc-9ab390-R1_A23WJ53LT4_1_1																																				137.5bp	97.9%	257.6M												87.2%	54%	151bp	151bp	18%	266.0M
aih-tih-sc-9ab390-R1_A23WJ53LT4_1_2																																																		86.1%	55%	151bp	151bp	18%	266.0M
aih-tih-sc-9ab390-R1_A23WJ53LT4_1_trimmed_1																																																		87.3%	55%	126bp	132bp	9%	263.2M	87.3%	55%	126bp	132bp	9%	263.2M
aih-tih-sc-9ab390-R1_A23WJ53LT4_1_trimmed_2																																																		86.9%	56%	126bp	132bp	9%	263.2M	86.9%	56%	126bp	132bp	9%	263.2M
aih-tih-sc-9be8d4-R1_A23WJ53LT4_1	9999000000	306245242	577337132	0.8815	593890728	0.01%	0.53%	279792240	0.94%	0.97%	0.05%	0.03%	263346106	133060899	12902974	4369857	496.46	241.00	0.75%	0.64%	0.98	0.000	142.2bp	129.0bp	0.01%	0.89%	0.36%	0.00%	0.02%	3.03%	0.61%	0.00%	0.02	No	0.00%				53.2%	90.7%	96.1%	285.5M	35.1%	97.5%	73720.9Mb	593.9M	56.7%	99.0%	58.2%
aih-tih-sc-9be8d4-R1_A23WJ53LT4_1_1																																				142.2bp	98.4%	292.2M												85.8%	55%	151bp	151bp	18%	412.4M
aih-tih-sc-9be8d4-R1_A23WJ53LT4_1_2																																																		85.3%	56%	151bp	151bp	18%	412.4M
aih-tih-sc-9be8d4-R1_A23WJ53LT4_1_trimmed_1																																																		83.5%	56%	127bp	137bp	9%	296.9M	83.5%	56%	127bp	137bp	9%	296.9M
aih-tih-sc-9be8d4-R1_A23WJ53LT4_1_trimmed_2																																																		83.9%	56%	127bp	137bp	9%	296.9M	83.9%	56%	127bp	137bp	9%	296.9M
aih-tih-sc-9ee8d4-R1_A23WJ53LT4_1	9999000000	288619319	508334276	0.9159	524467334	0.00%	0.50%	260709510	0.94%	0.96%	0.05%	0.04%	244966873	123756511	13437554	4778572	460.72	205.00	0.74%	0.61%	0.98	0.000	141.7bp	129.0bp	0.01%	0.99%	0.46%	0.00%	0.02%	3.06%	0.71%	0.00%	0.01	No	0.00%				50.5%	89.9%	96.1%	251.9M	33.6%	97.6%	65081.4Mb	524.5M	54.7%	99.0%	58.0%
aih-tih-sc-9ee8d4-R1_A23WJ53LT4_1_1																																				141.7bp	98.0%	257.1M												82.1%	53%	151bp	151bp	18%	265.0M
aih-tih-sc-9ee8d4-R1_A23WJ53LT4_1_2																																																		81.3%	54%	151bp	151bp	18%	265.0M
aih-tih-sc-9ee8d4-R1_A23WJ53LT4_1_trimmed_1																																																		82.2%	54%	127bp	137bp	9%	262.2M	82.2%	54%	127bp	137bp	9%	262.2M
aih-tih-sc-9ee8d4-R1_A23WJ53LT4_1_trimmed_2																																																		82.1%	54%	127bp	137bp	9%	262.2M	82.1%	54%	127bp	137bp	9%	262.2M
aih-tih-sc-9f6030-R1_A23WJ53LT4_1	9999000000	64306610	506224722	0.8883	525393076	0.01%	0.85%	76388254	0.86%	0.91%	0.10%	0.09%	65406975	32888864	7464898	3169921	103.34	43.00	0.57%	0.30%	0.98	0.000	128.7bp	120.0bp	0.00%	0.65%	0.40%	0.00%	0.01%	2.11%	0.66%	0.00%	0.02	No	0.00%				86.0%	87.7%	95.5%	251.0M	57.7%	97.5%	62079.3Mb	525.4M	58.0%	98.7%	70.3%
aih-tih-sc-9f6030-R1_A23WJ53LT4_1_1																																				128.7bp	97.8%	257.0M												89.9%	56%	151bp	151bp	18%	266.1M
aih-tih-sc-9f6030-R1_A23WJ53LT4_1_2																																																		88.5%	56%	151bp	151bp	18%	266.1M
aih-tih-sc-9f6030-R1_A23WJ53LT4_1_trimmed_1																																																		90.0%	57%	121bp	122bp	9%	262.7M	90.0%	57%	121bp	122bp	9%	262.7M
aih-tih-sc-9f6030-R1_A23WJ53LT4_1_trimmed_2																																																		89.5%	58%	121bp	122bp	9%	262.7M	89.5%	58%	121bp	122bp	9%	262.7M
aih-tih-sc-9faac1-R1_A23WJ53LT4_1	9999000000	86517903	564544906	0.9097	592246724	0.01%	0.82%	108769120	0.89%	0.93%	0.08%	0.07%	96272774	48555401	8657586	3378264	168.59	68.00	0.63%	0.42%	0.98	0.000	141.9bp	130.0bp	0.02%	0.96%	0.45%	0.00%	0.04%	2.98%	0.70%	0.00%	0.01	No	0.00%				82.2%	86.2%	94.5%	279.8M	60.1%	97.5%	73545.4Mb	592.2M	58.4%	98.7%	59.4%
aih-tih-sc-9faac1-R1_A23WJ53LT4_1_1																																				141.9bp	98.0%	290.2M												89.7%	57%	151bp	151bp	18%	306.7M
aih-tih-sc-9faac1-R1_A23WJ53LT4_1_2																																																		88.4%	57%	151bp	151bp	18%	306.7M
aih-tih-sc-9faac1-R1_A23WJ53LT4_1_trimmed_1																																																		89.7%	58%	127bp	137bp	9%	296.1M	89.7%	58%	127bp	137bp	9%	296.1M
aih-tih-sc-9faac1-R1_A23WJ53LT4_1_trimmed_2																																																		89.4%	58%	127bp	137bp	9%	296.1M	89.4%	58%	127bp	137bp	9%	296.1M
aih-tih-sc-9fb608-R1_A23WJ53LT4_1	9999000000	156254758	573473618	0.8861	593449412	0.01%	0.67%	197784536	0.92%	0.96%	0.06%	0.04%	182253060	92382766	11915528	4029782	352.81	166.00	0.75%	0.60%	0.98	0.000	155.6bp	141.0bp	0.00%	0.59%	0.41%	0.00%	0.01%	1.90%	0.67%	0.00%	5.99	No	0.00%				67.1%	89.2%	95.8%	284.2M	48.7%	97.4%	76062.1Mb	593.4M	57.8%	98.9%	50.5%
aih-tih-sc-9fb608-R1_A23WJ53LT4_1_1																																				155.6bp	97.5%	289.2M												87.1%	56%	151bp	151bp	18%	320.5M
aih-tih-sc-9fb608-R1_A23WJ53LT4_1_2																																																		86.0%	57%	151bp	151bp	18%	320.5M
aih-tih-sc-9fb608-R1_A23WJ53LT4_1_trimmed_1																																																		86.7%	57%	131bp	147bp	9%	296.7M	86.7%	57%	131bp	147bp	9%	296.7M
aih-tih-sc-9fb608-R1_A23WJ53LT4_1_trimmed_2																																																		86.5%	58%	132bp	147bp	9%	296.7M	86.5%	58%	132bp	147bp	9%	296.7M
aih-tih-sc-a19eaa-R1_A23WJ53LT4_1	9999000000	124402712	578494085	0.9240	593348886	0.01%	0.74%	152034057	0.92%	0.96%	0.06%	0.04%	140390621	70751232	8548566	3219856	242.24	106.00	0.69%	0.51%	0.98	0.000	130.5bp	120.0bp	0.01%	0.59%	0.40%	0.00%	0.01%	2.03%	0.68%	0.00%	0.01	No	0.00%				74.8%	91.0%	96.4%	285.9M	49.7%	97.5%	71161.9Mb	593.3M	57.6%	98.9%	66.5%
aih-tih-sc-a19eaa-R1_A23WJ53LT4_1_1																																				130.5bp	98.6%	292.5M												90.6%	56%	151bp	151bp	27%	421.9M
aih-tih-sc-a19eaa-R1_A23WJ53LT4_1_2																																																		89.8%	56%	151bp	151bp	27%	421.9M
aih-tih-sc-a19eaa-R1_A23WJ53LT4_1_trimmed_1																																																		88.6%	57%	123bp	127bp	18%	296.7M	88.6%	57%	123bp	127bp	18%	296.7M
aih-tih-sc-a19eaa-R1_A23WJ53LT4_1_trimmed_2																																																		88.6%	57%	123bp	127bp	18%	296.7M	88.6%	57%	123bp	127bp	18%	296.7M
aih-tih-sc-af602e-R1_A23WJ53LT4_1	9999000000	206710506	577428378	0.9449	592384384	0.00%	0.61%	232783306	0.94%	0.96%	0.05%	0.04%	217907592	110071337	12293760	4286890	411.56	206.00	0.77%	0.63%	0.98	0.000	146.0bp	134.0bp	0.01%	0.82%	0.42%	0.00%	0.01%	2.69%	0.67%	0.00%	0.00	No	0.00%				61.0%	91.4%	96.5%	285.7M	43.2%	97.5%	74848.8Mb	592.4M	54.9%	98.7%	55.1%
aih-tih-sc-af602e-R1_A23WJ53LT4_1_1																																				146.0bp	98.3%	291.2M												85.3%	54%	151bp	151bp	18%	309.4M
aih-tih-sc-af602e-R1_A23WJ53LT4_1_2																																																		84.3%	55%	151bp	151bp	18%	309.4M
aih-tih-sc-af602e-R1_A23WJ53LT4_1_trimmed_1																																																		85.2%	54%	130bp	142bp	18%	296.2M	85.2%	54%	130bp	142bp	18%	296.2M
aih-tih-sc-af602e-R1_A23WJ53LT4_1_trimmed_2																																																		85.1%	55%	130bp	142bp	9%	296.2M	85.1%	55%	130bp	142bp	9%	296.2M
aih-tih-sc-b107e7-R1_A23WJ53LT4_1	9999000000	158975526	579500071	0.9609	593188814	0.00%	0.67%	193061228	0.93%	0.96%	0.05%	0.04%	179924354	91021588	10259030	3429084	343.97	136.00	0.70%	0.55%	0.98	0.000	146.4bp	133.0bp	0.01%	0.64%	0.49%	0.00%	0.01%	2.20%	0.83%	0.00%	0.02	No	0.00%				67.8%	91.8%	96.7%	286.9M	48.1%	97.5%	74869.7Mb	593.2M	57.9%	98.9%	54.3%
aih-tih-sc-b107e7-R1_A23WJ53LT4_1_1																																				146.4bp	98.5%	292.0M												90.8%	56%	151bp	151bp	27%	479.8M
aih-tih-sc-b107e7-R1_A23WJ53LT4_1_2																																																		89.6%	57%	151bp	151bp	18%	479.8M
aih-tih-sc-b107e7-R1_A23WJ53LT4_1_trimmed_1																																																		88.1%	57%	129bp	142bp	18%	296.6M	88.1%	57%	129bp	142bp	18%	296.6M
aih-tih-sc-b107e7-R1_A23WJ53LT4_1_trimmed_2																																																		87.8%	58%	130bp	142bp	18%	296.6M	87.8%	58%	130bp	142bp	18%	296.6M
aih-tih-sc-b675f7-R1_A23WJ53LT4_1	9999000000	263527850	575982574	0.9608	592829550	0.00%	0.55%	269579993	0.94%	0.97%	0.05%	0.03%	253160646	128132592	13591067	4437348	502.63	288.00	0.78%	0.67%	0.98	0.000	153.5bp	139.0bp	0.01%	0.86%	0.37%	0.00%	0.01%	2.72%	0.56%	0.00%	0.00	No	0.00%				54.8%	90.6%	96.2%	285.1M	39.9%	97.6%	76266.6Mb	592.8M	54.6%	98.8%	50.5%
aih-tih-sc-b675f7-R1_A23WJ53LT4_1_1																																				153.5bp	98.2%	290.9M												87.1%	53%	151bp	151bp	18%	377.5M
aih-tih-sc-b675f7-R1_A23WJ53LT4_1_2																																																		85.7%	54%	151bp	151bp	18%	377.5M
aih-tih-sc-b675f7-R1_A23WJ53LT4_1_trimmed_1																																																		85.5%	54%	132bp	147bp	9%	296.4M	85.5%	54%	132bp	147bp	9%	296.4M
aih-tih-sc-b675f7-R1_A23WJ53LT4_1_trimmed_2																																																		85.2%	54%	132bp	147bp	9%	296.4M	85.2%	54%	132bp	147bp	9%	296.4M
aih-tih-sc-b7f13b-R1_A23WJ53LT4_1	9999000000	252268471	574796621	0.9349	592819958	0.00%	0.55%	264832175	0.93%	0.96%	0.06%	0.04%	246664393	125065991	15218999	5045771	495.76	259.00	0.75%	0.65%	0.98	0.000	159.9bp	144.0bp	0.01%	0.97%	0.50%	0.00%	0.02%	3.00%	0.73%	0.00%	0.00	No	0.00%				55.6%	90.3%	96.2%	285.0M	40.6%	97.5%	76978.9Mb	592.8M	54.8%	98.8%	47.4%
aih-tih-sc-b7f13b-R1_A23WJ53LT4_1_1																																				159.9bp	97.7%	289.7M												85.0%	54%	151bp	151bp	18%	340.8M
aih-tih-sc-b7f13b-R1_A23WJ53LT4_1_2																																																		84.3%	54%	151bp	151bp	18%	340.8M
aih-tih-sc-b7f13b-R1_A23WJ53LT4_1_trimmed_1																																																		84.0%	54%	133bp	151bp	9%	296.4M	84.0%	54%	133bp	151bp	9%	296.4M
aih-tih-sc-b7f13b-R1_A23WJ53LT4_1_trimmed_2																																																		84.3%	55%	133bp	151bp	9%	296.4M	84.3%	55%	133bp	151bp	9%	296.4M
aih-tih-sc-bec563-R1_A23WJ53LT4_1	9999000000	310225313	576882955	0.9526	593989872	0.01%	0.52%	284488632	0.94%	0.97%	0.05%	0.03%	268263776	135976094	13224629	4006710	543.63	256.00	0.76%	0.65%	0.98	0.000	158.2bp	143.0bp	0.01%	0.99%	0.54%	0.00%	0.01%	3.17%	0.87%	0.00%	0.07	No	0.00%				52.4%	90.3%	96.2%	285.8M	38.0%	97.5%	76894.0Mb	594.0M	56.1%	99.0%	48.6%
aih-tih-sc-bec563-R1_A23WJ53LT4_1_1																																				158.2bp	98.2%	291.7M												87.0%	55%	151bp	151bp	18%	417.9M
aih-tih-sc-bec563-R1_A23WJ53LT4_1_2																																																		86.1%	55%	151bp	151bp	18%	417.9M
aih-tih-sc-bec563-R1_A23WJ53LT4_1_trimmed_1																																																		84.7%	55%	133bp	151bp	9%	297.0M	84.7%	55%	133bp	151bp	9%	297.0M
aih-tih-sc-bec563-R1_A23WJ53LT4_1_trimmed_2																																																		84.6%	56%	133bp	151bp	9%	297.0M	84.6%	56%	133bp	151bp	9%	297.0M
aih-tih-sc-c8485b-R1_A23WJ53LT4_1	9990000000	178238875	573105581	0.9081	592141524	0.01%	0.65%	208900334	0.93%	0.95%	0.06%	0.05%	193535085	97536258	12242233	4650634	344.98	168.00	0.72%	0.59%	0.98	0.000	136.0bp	124.0bp	0.01%	0.92%	0.35%	0.00%	0.03%	3.01%	0.58%	0.00%	0.76	Yes	0.31%				65.1%	89.4%	95.9%	283.8M	43.0%	97.5%	72058.8Mb	592.1M	55.8%	98.7%	61.7%
aih-tih-sc-c8485b-R1_A23WJ53LT4_1_1																																				136.0bp	98.2%	290.8M												87.3%	54%	151bp	151bp	18%	392.9M
aih-tih-sc-c8485b-R1_A23WJ53LT4_1_2																																																		85.9%	55%	151bp	151bp	18%	392.9M
aih-tih-sc-c8485b-R1_A23WJ53LT4_1_trimmed_1																																																		85.2%	55%	125bp	132bp	9%	296.1M	85.2%	55%	125bp	132bp	9%	296.1M
aih-tih-sc-c8485b-R1_A23WJ53LT4_1_trimmed_2																																																		85.0%	56%	125bp	132bp	9%	296.1M	85.0%	56%	125bp	132bp	9%	296.1M
aih-tih-sc-cab2fc-R1_A23WJ53LT4_1	9999000000	378301124	571829544	0.8791	592464782	0.00%	0.49%	304178200	0.94%	0.97%	0.05%	0.03%	287123411	145511853	14331569	4329324	587.31	267.00	0.75%	0.64%	0.98	0.000	158.9bp	143.0bp	0.01%	0.68%	0.42%	0.00%	0.02%	2.19%	0.66%	0.00%	0.00	No	0.00%				48.9%	88.3%	95.7%	283.4M	34.9%	97.5%	76209.3Mb	592.5M	56.0%	98.7%	47.7%
aih-tih-sc-cab2fc-R1_A23WJ53LT4_1_1																																				158.9bp	98.2%	291.0M												87.9%	55%	151bp	151bp	18%	471.6M
aih-tih-sc-cab2fc-R1_A23WJ53LT4_1_2																																																		86.9%	55%	151bp	151bp	18%	471.6M
aih-tih-sc-cab2fc-R1_A23WJ53LT4_1_trimmed_1																																																		85.0%	55%	132bp	151bp	18%	296.2M	85.0%	55%	132bp	151bp	18%	296.2M
aih-tih-sc-cab2fc-R1_A23WJ53LT4_1_trimmed_2																																																		85.2%	56%	132bp	151bp	9%	296.2M	85.2%	56%	132bp	151bp	9%	296.2M
aih-tih-sc-cdd9d2-R1_A23WJ53LT4_1	9990000000	290857080	577539623	0.9216	593787946	0.00%	0.56%	260952476	0.94%	0.97%	0.05%	0.03%	245348101	124365511	12862907	4000367	502.11	235.00	0.75%	0.63%	0.97	0.000	157.9bp	143.0bp	0.01%	0.62%	0.55%	0.00%	0.02%	2.20%	0.93%	0.00%	0.02	No	0.00%				56.3%	90.4%	96.4%	286.2M	41.4%	97.3%	77218.2Mb	593.8M	56.5%	99.0%	47.3%
aih-tih-sc-cdd9d2-R1_A23WJ53LT4_1_1																																				157.9bp	98.3%	291.7M												88.7%	55%	151bp	151bp	18%	460.3M
aih-tih-sc-cdd9d2-R1_A23WJ53LT4_1_2																																																		87.7%	56%	151bp	151bp	18%	460.3M
aih-tih-sc-cdd9d2-R1_A23WJ53LT4_1_trimmed_1																																																		86.0%	56%	134bp	151bp	9%	296.9M	86.0%	56%	134bp	151bp	9%	296.9M
aih-tih-sc-cdd9d2-R1_A23WJ53LT4_1_trimmed_2																																																		85.9%	56%	134bp	151bp	9%	296.9M	85.9%	56%	134bp	151bp	9%	296.9M
aih-tih-sc-ce4cdc-R1_A23WJ53LT4_1	9999000000	131523298	425502858	0.9409	440401502	0.01%	0.65%	153711826	0.92%	0.95%	0.06%	0.05%	142093127	71538841	9171065	3648590	238.31	129.00	0.73%	0.55%	0.98	0.000	132.5bp	122.0bp	0.01%	1.71%	0.43%	0.00%	0.01%	5.08%	0.68%	0.00%	0.88	Yes	3.13%				65.5%	88.8%	95.5%	210.3M	43.7%	97.6%	52839.1Mb	440.4M	53.8%	98.7%	67.1%
aih-tih-sc-ce4cdc-R1_A23WJ53LT4_1_1																																				132.5bp	98.1%	216.0M												83.7%	52%	151bp	151bp	18%	223.0M
aih-tih-sc-ce4cdc-R1_A23WJ53LT4_1_2																																																		82.6%	53%	151bp	151bp	18%	223.0M
aih-tih-sc-ce4cdc-R1_A23WJ53LT4_1_trimmed_1																																																		83.7%	53%	123bp	127bp	9%	220.2M	83.7%	53%	123bp	127bp	9%	220.2M
aih-tih-sc-ce4cdc-R1_A23WJ53LT4_1_trimmed_2																																																		83.7%	54%	123bp	127bp	9%	220.2M	83.7%	54%	123bp	127bp	9%	220.2M
aih-tih-sc-ced210-R1_A23WJ53LT4_1	9999000000	213857107	572167889	0.9420	593210418	0.01%	0.60%	240143537	0.93%	0.96%	0.06%	0.04%	222988178	112697495	13516394	4886029	408.39	209.00	0.75%	0.62%	0.98	0.000	140.8bp	129.0bp	0.00%	1.13%	0.50%	0.00%	0.01%	3.49%	0.80%	0.00%	0.01	No	0.00%				59.9%	88.7%	95.5%	283.2M	41.0%	97.6%	73426.8Mb	593.2M	55.9%	98.9%	59.1%
aih-tih-sc-ced210-R1_A23WJ53LT4_1_1																																				140.8bp	97.3%	288.7M												85.8%	54%	151bp	151bp	18%	321.7M
aih-tih-sc-ced210-R1_A23WJ53LT4_1_2																																																		85.0%	55%	151bp	151bp	18%	321.7M
aih-tih-sc-ced210-R1_A23WJ53LT4_1_trimmed_1																																																		85.3%	55%	127bp	137bp	9%	296.6M	85.3%	55%	127bp	137bp	9%	296.6M
aih-tih-sc-ced210-R1_A23WJ53LT4_1_trimmed_2																																																		85.4%	56%	127bp	137bp	9%	296.6M	85.4%	56%	127bp	137bp	9%	296.6M
aih-tih-sc-cf89e7-R1_A23WJ53LT4_1	9999000000	35905823	176179515	0.9262	184096348	0.01%	0.80%	37606125	0.86%	0.90%	0.11%	0.10%	32297211	16224271	4041075	1755333	50.13	22.00	0.44%	0.14%	0.98	0.000	128.4bp	119.0bp	0.01%	0.55%	0.20%	0.00%	0.01%	1.79%	0.33%	0.00%	0.01	No	0.00%				80.1%	86.6%	94.9%	87.4M	51.6%	97.5%	21503.1Mb	184.1M	56.3%	98.4%	69.6%
aih-tih-sc-cf89e7-R1_A23WJ53LT4_1_1																																				128.4bp	97.5%	89.7M												85.1%	55%	151bp	151bp	18%	93.5M
aih-tih-sc-cf89e7-R1_A23WJ53LT4_1_2																																																		83.3%	55%	151bp	151bp	27%	93.5M
aih-tih-sc-cf89e7-R1_A23WJ53LT4_1_trimmed_1																																																		85.1%	56%	120bp	122bp	9%	92.0M	85.1%	56%	120bp	122bp	9%	92.0M
aih-tih-sc-cf89e7-R1_A23WJ53LT4_1_trimmed_2																																																		84.4%	56%	120bp	122bp	9%	92.0M	84.4%	56%	120bp	122bp	9%	92.0M
aih-tih-sc-d45d48-R1_A23WJ53LT4_1	9999000000	59937488	348268852	0.9289	366674730	0.01%	0.81%	70144729	0.88%	0.93%	0.09%	0.07%	61475023	31066851	6035092	2341017	110.40	39.00	0.55%	0.30%	0.98	0.000	148.8bp	137.0bp	0.00%	0.66%	0.37%	0.00%	0.01%	2.15%	0.62%	0.00%	4.97	No	0.00%				81.5%	83.8%	94.2%	172.8M	60.7%	97.4%	46314.1Mb	366.7M	58.8%	98.7%	55.0%
aih-tih-sc-d45d48-R1_A23WJ53LT4_1_1																																				148.8bp	97.5%	178.8M												88.6%	57%	151bp	151bp	18%	185.8M
aih-tih-sc-d45d48-R1_A23WJ53LT4_1_2																																																		87.0%	58%	151bp	151bp	18%	185.8M
aih-tih-sc-d45d48-R1_A23WJ53LT4_1_trimmed_1																																																		88.7%	58%	130bp	142bp	9%	183.3M	88.7%	58%	130bp	142bp	9%	183.3M
aih-tih-sc-d45d48-R1_A23WJ53LT4_1_trimmed_2																																																		88.0%	59%	130bp	142bp	9%	183.3M	88.0%	59%	130bp	142bp	9%	183.3M
aih-tih-sc-d64bdd-R1_A23WJ53LT4_1	9999000000	219775049	496795253	0.9401	514671794	0.00%	0.55%	232608820	0.94%	0.97%	0.05%	0.03%	218094994	110534985	11984123	3712582	439.12	201.00	0.72%	0.61%	0.98	0.000	161.5bp	145.0bp	0.00%	0.93%	0.47%	0.00%	0.01%	2.86%	0.72%	0.00%	4.16	No	0.00%				55.1%	88.9%	95.8%	246.5M	39.7%	97.5%	66791.1Mb	514.7M	57.3%	98.7%	47.0%
aih-tih-sc-d64bdd-R1_A23WJ53LT4_1_1																																				161.5bp	98.0%	252.1M												83.4%	56%	151bp	151bp	18%	260.7M
aih-tih-sc-d64bdd-R1_A23WJ53LT4_1_2																																																		82.8%	57%	151bp	151bp	18%	260.7M
aih-tih-sc-d64bdd-R1_A23WJ53LT4_1_trimmed_1																																																		83.5%	56%	133bp	151bp	9%	257.3M	83.5%	56%	133bp	151bp	9%	257.3M
aih-tih-sc-d64bdd-R1_A23WJ53LT4_1_trimmed_2																																																		83.8%	57%	133bp	151bp	9%	257.3M	83.8%	57%	133bp	151bp	9%	257.3M
aih-tih-sc-da460d-R1_A23WJ53LT4_1	9999000000	231408202	577099424	0.9437	592108088	0.00%	0.59%	243070756	0.94%	0.97%	0.04%	0.03%	229307496	115662364	10876407	3716778	424.00	176.00	0.72%	0.59%	0.98	0.000	138.6bp	126.0bp	0.00%	0.97%	0.75%	0.00%	0.01%	3.07%	1.13%	0.00%	5.79	No	0.00%				59.2%	91.6%	96.4%	285.4M	39.2%	97.5%	72797.4Mb	592.1M	56.8%	98.7%	60.1%
aih-tih-sc-da460d-R1_A23WJ53LT4_1_1																																				138.6bp	98.6%	291.8M												88.1%	55%	151bp	151bp	18%	426.4M
aih-tih-sc-da460d-R1_A23WJ53LT4_1_2																																																		87.2%	56%	151bp	151bp	18%	426.4M
aih-tih-sc-da460d-R1_A23WJ53LT4_1_trimmed_1																																																		85.7%	56%	126bp	137bp	9%	296.1M	85.7%	56%	126bp	137bp	9%	296.1M
aih-tih-sc-da460d-R1_A23WJ53LT4_1_trimmed_2																																																		86.0%	56%	126bp	137bp	9%	296.1M	86.0%	56%	126bp	137bp	9%	296.1M
aih-tih-sc-e33b0b-R1_A23WJ53LT4_1	9999000000	138009953	567941230	0.9559	592064384	0.00%	0.71%	172028581	0.93%	0.96%	0.06%	0.04%	159162798	80402093	10115477	3593324	296.91	120.00	0.69%	0.53%	0.98	0.000	145.5bp	132.0bp	0.01%	0.62%	0.32%	0.00%	0.02%	1.81%	0.46%	0.00%	5.32	No	0.00%				71.3%	88.5%	95.2%	282.0M	48.4%	97.6%	73429.1Mb	592.1M	54.7%	98.7%	56.4%
aih-tih-sc-e33b0b-R1_A23WJ53LT4_1_1																																				145.5bp	98.2%	290.8M												90.2%	53%	151bp	151bp	18%	462.2M
aih-tih-sc-e33b0b-R1_A23WJ53LT4_1_2																																																		88.9%	54%	151bp	151bp	18%	462.2M
aih-tih-sc-e33b0b-R1_A23WJ53LT4_1_trimmed_1																																																		87.5%	54%	127bp	137bp	9%	296.0M	87.5%	54%	127bp	137bp	9%	296.0M
aih-tih-sc-e33b0b-R1_A23WJ53LT4_1_trimmed_2																																																		87.2%	55%	127bp	142bp	9%	296.0M	87.2%	55%	127bp	142bp	9%	296.0M
aih-tih-sc-e4cfff-R1_A23WJ53LT4_1	9999000000	85118193	502686834	0.9113	524224140	0.01%	0.81%	97673111	0.87%	0.91%	0.10%	0.09%	84662446	42642244	9578668	4041190	142.30	65.00	0.63%	0.40%	0.98	0.000	137.2bp	128.0bp	0.01%	0.59%	0.36%	0.00%	0.02%	2.00%	0.61%	0.00%	0.01	No	0.00%				81.9%	85.9%	95.0%	249.0M	58.7%	97.5%	64603.8Mb	524.2M	57.0%	98.8%	62.9%
aih-tih-sc-e4cfff-R1_A23WJ53LT4_1_1																																				137.2bp	97.8%	256.4M												88.8%	55%	151bp	151bp	18%	265.4M
aih-tih-sc-e4cfff-R1_A23WJ53LT4_1_2																																																		87.4%	56%	151bp	151bp	18%	265.4M
aih-tih-sc-e4cfff-R1_A23WJ53LT4_1_trimmed_1																																																		89.0%	56%	126bp	132bp	9%	262.1M	89.0%	56%	126bp	132bp	9%	262.1M
aih-tih-sc-e4cfff-R1_A23WJ53LT4_1_trimmed_2																																																		88.4%	57%	126bp	132bp	9%	262.1M	88.4%	57%	126bp	132bp	9%	262.1M
aih-tih-sc-f29b4f-R1_A23WJ53LT4_1	9999000000	121370987	362189973	0.9183	374107578	0.01%	0.62%	142644355	0.93%	0.96%	0.06%	0.04%	132575254	66903088	8160774	3014448	241.01	127.00	0.72%	0.55%	0.98	0.000	137.7bp	125.0bp	0.01%	0.73%	0.31%	0.00%	0.01%	2.44%	0.52%	0.00%	0.01	No	0.00%				62.2%	89.9%	96.0%	179.5M	40.9%	97.5%	45473.2Mb	374.1M	56.1%	98.7%	60.2%
aih-tih-sc-f29b4f-R1_A23WJ53LT4_1_1																																				137.7bp	98.2%	183.7M												82.4%	55%	151bp	151bp	18%	189.6M
aih-tih-sc-f29b4f-R1_A23WJ53LT4_1_2																																																		81.5%	56%	151bp	151bp	18%	189.6M
aih-tih-sc-f29b4f-R1_A23WJ53LT4_1_trimmed_1																																																		82.5%	55%	125bp	132bp	9%	187.1M	82.5%	55%	125bp	132bp	9%	187.1M
aih-tih-sc-f29b4f-R1_A23WJ53LT4_1_trimmed_2																																																		82.5%	56%	125bp	132bp	9%	187.1M	82.5%	56%	125bp	132bp	9%	187.1M
aih-tih-sc-f2a1b0-R1_A23WJ53LT4_1	9999000000	2235409	5923550	0.8673	6374474	0.01%	0.73%	1693554	0.81%	0.86%	0.14%	0.14%	1374543	688440	235747	110964	1.77	0.00	0.00%	0.00%	0.97	0.000	106.4bp	100.0bp	0.01%	0.66%	0.16%	0.00%	0.01%	2.10%	0.29%	0.00%	1.24	Skipped	N/A%				74.4%	75.2%	91.9%	2.9M	36.0%	97.3%	643.0Mb	6.4M	59.4%	94.1%	85.3%
aih-tih-sc-f2a1b0-R1_A23WJ53LT4_1_1																																				106.4bp	95.7%	3.1M												75.3%	58%	151bp	151bp	36%	3.4M
aih-tih-sc-f2a1b0-R1_A23WJ53LT4_1_2																																																		74.1%	59%	151bp	151bp	36%	3.4M
aih-tih-sc-f2a1b0-R1_A23WJ53LT4_1_trimmed_1																																																		74.1%	59%	103bp	102bp	9%	3.2M	74.1%	59%	103bp	102bp	9%	3.2M
aih-tih-sc-f2a1b0-R1_A23WJ53LT4_1_trimmed_2																																																		73.7%	59%	104bp	102bp	9%	3.2M	73.7%	59%	104bp	102bp	9%	3.2M
aih-tih-sc-fee548-R1_A23WJ53LT4_1	9999000000	251444539	544699474	0.9621	564822286	0.00%	0.55%	251771088	0.95%	0.97%	0.04%	0.03%	238713574	120685046	10752749	3252319	471.01	212.00	0.73%	0.61%	0.98	0.000	152.9bp	136.0bp	0.01%	0.94%	0.47%	0.00%	0.02%	2.69%	0.67%	0.00%	0.00	No	0.00%				55.7%	89.6%	95.6%	270.1M	38.6%	97.6%	71489.2Mb	564.8M	54.5%	98.7%	52.2%
aih-tih-sc-fee548-R1_A23WJ53LT4_1_1																																				152.9bp	98.5%	278.1M												84.5%	53%	151bp	151bp	18%	286.0M
aih-tih-sc-fee548-R1_A23WJ53LT4_1_2																																																		83.4%	54%	151bp	151bp	18%	286.0M
aih-tih-sc-fee548-R1_A23WJ53LT4_1_trimmed_1																																																		84.5%	54%	130bp	147bp	9%	282.4M	84.5%	54%	130bp	147bp	9%	282.4M
aih-tih-sc-fee548-R1_A23WJ53LT4_1_trimmed_2																																																		84.5%	54%	130bp	147bp	9%	282.4M	84.5%	54%	130bp	147bp	9%	282.4M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: RSeQC	Unique Reads	Reads with mapq >= mapq_cut (uniquely mapped)	`unique_reads_rseqc`	None
\|\|	Custom content: RSeQC	Frac Antisense	Fraction of reads explained by antisense orientation (1+-,1-+,2++,2--)	`frac_antisense`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Expression QC	ChrY Signature Score	Mean log2(TPM+1) score for chrY signature genes; used for sex verification.	`score_log2tpm1_mean_chry_signature`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_HD789_01_RNA_13_A23WJ53LT4_1	631.3M	0.0M	0.0M	36.1M	2.5M	576.3M	288.3M	288.0M	288.2M	288.1M	268.6M	307.7M	574.8M	0.0M
FFPE_V4_0002_RNA_0006_A23WJ53LT4_1	638.9M	0.0M	0.0M	43.5M	3.3M	573.3M	286.8M	286.5M	286.7M	286.6M	285.6M	287.7M	571.6M	0.0M
NTC_0001_0001_A23WJ53LT4_1	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
aih-tih-sc-00d05f-R1_A23WJ53LT4_1	497.9M	0.0M	0.0M	39.0M	2.5M	441.6M	220.9M	220.6M	220.8M	220.7M	238.9M	202.7M	440.2M	0.0M
aih-tih-sc-0419d4-R1_A23WJ53LT4_1	413.9M	0.0M	0.0M	32.3M	1.9M	366.5M	183.3M	183.2M	183.3M	183.2M	212.6M	153.9M	365.1M	0.0M
aih-tih-sc-06a169-R1_A23WJ53LT4_1	603.9M	0.0M	0.0M	52.4M	3.2M	528.6M	264.5M	264.1M	264.3M	264.3M	291.6M	236.9M	527.1M	0.0M
aih-tih-sc-0992e4-R1_A23WJ53LT4_1	633.0M	0.0M	0.0M	36.9M	3.3M	576.1M	288.2M	287.9M	288.1M	288.0M	286.2M	289.9M	574.1M	0.0M
aih-tih-sc-09b6a3-R1_A23WJ53LT4_1	514.6M	0.0M	0.0M	50.2M	2.5M	443.5M	221.9M	221.6M	221.8M	221.7M	272.0M	171.5M	442.0M	0.0M
aih-tih-sc-0ce15f-R1_A23WJ53LT4_1	376.0M	0.0M	0.0M	33.7M	2.2M	325.1M	162.6M	162.4M	162.6M	162.5M	198.1M	126.9M	324.0M	0.0M
aih-tih-sc-12b72b-R1_A23WJ53LT4_1	644.0M	0.0M	0.0M	49.3M	3.1M	571.0M	285.6M	285.3M	285.6M	285.4M	320.1M	250.9M	568.6M	0.0M
aih-tih-sc-1351d2-R1_A23WJ53LT4_1	561.2M	0.0M	0.0M	57.2M	2.3M	483.4M	241.5M	241.9M	241.7M	241.6M	242.0M	241.4M	481.2M	0.0M
aih-tih-sc-19e09e-R1_A23WJ53LT4_1	492.9M	0.0M	0.0M	37.4M	2.3M	438.4M	219.3M	219.1M	219.2M	219.2M	234.6M	203.8M	436.6M	0.0M
aih-tih-sc-1dd7a6-R1_A23WJ53LT4_1	638.8M	0.0M	0.0M	44.8M	2.7M	572.5M	286.4M	286.1M	286.3M	286.2M	301.3M	271.2M	570.6M	0.0M
aih-tih-sc-1ffee4-R1_A23WJ53LT4_1	570.2M	0.0M	0.0M	33.4M	2.7M	520.0M	260.1M	259.9M	260.1M	259.9M	246.0M	274.0M	518.2M	0.0M
aih-tih-sc-2482ef-R1_A23WJ53LT4_1	68.6M	0.0M	0.0M	7.1M	0.5M	58.5M	29.3M	29.2M	29.3M	29.3M	35.1M	23.4M	58.3M	0.0M
aih-tih-sc-2798bb-R1_A23WJ53LT4_1	642.0M	0.0M	0.0M	46.9M	2.7M	572.5M	286.4M	286.1M	286.3M	286.2M	285.2M	287.3M	570.7M	0.0M
aih-tih-sc-284856-R1_A23WJ53LT4_1	148.7M	0.0M	0.0M	9.6M	0.6M	134.3M	67.2M	67.1M	67.1M	67.1M	69.6M	64.6M	133.8M	0.0M
aih-tih-sc-2905df-R1_A23WJ53LT4_1	636.3M	0.0M	0.0M	40.4M	2.6M	575.5M	287.9M	287.6M	287.8M	287.7M	295.4M	280.0M	573.7M	0.0M
aih-tih-sc-2a8dd7-R1_A23WJ53LT4_1	644.5M	0.0M	0.0M	48.5M	2.8M	571.2M	285.8M	285.4M	285.6M	285.6M	320.2M	251.0M	569.3M	0.0M
aih-tih-sc-2ca847-R1_A23WJ53LT4_1	365.9M	0.0M	0.0M	29.4M	2.0M	322.6M	161.4M	161.2M	161.3M	161.3M	182.4M	140.2M	321.5M	0.0M
aih-tih-sc-2d4b78-R1_A23WJ53LT4_1	643.1M	0.0M	0.0M	47.9M	3.1M	572.4M	286.4M	286.0M	286.2M	286.2M	303.0M	269.4M	570.7M	0.0M
aih-tih-sc-331e97-R1_A23WJ53LT4_1	1.8M	0.0M	0.0M	0.4M	0.0M	1.3M	0.6M	0.6M	0.6M	0.6M	1.0M	0.3M	1.3M	0.0M
aih-tih-sc-33eb27-R1_A23WJ53LT4_1	661.2M	0.0M	0.0M	65.2M	2.9M	565.1M	282.7M	282.4M	282.6M	282.5M	321.7M	243.4M	563.2M	0.0M
aih-tih-sc-387c73-R1_A23WJ53LT4_1	634.3M	0.0M	0.0M	38.5M	3.0M	575.6M	287.9M	287.6M	287.9M	287.7M	296.0M	279.6M	573.7M	0.0M
aih-tih-sc-38a0a3-R1_A23WJ53LT4_1	633.3M	0.0M	0.0M	39.3M	2.6M	573.7M	287.0M	286.7M	286.9M	286.8M	290.8M	282.9M	571.8M	0.0M
aih-tih-sc-3a13e9-R1_A23WJ53LT4_1	643.5M	0.0M	0.0M	48.8M	3.2M	572.2M	286.2M	286.0M	286.1M	286.1M	305.3M	266.9M	570.5M	0.0M
aih-tih-sc-3a9c1f-R1_A23WJ53LT4_1	648.1M	0.0M	0.0M	57.1M	3.1M	564.7M	282.5M	282.2M	282.4M	282.3M	305.9M	258.9M	563.1M	0.0M
aih-tih-sc-3b54a2-R1_A23WJ53LT4_1	448.5M	0.0M	0.0M	35.0M	2.1M	396.6M	198.4M	198.1M	198.3M	198.2M	231.6M	165.0M	395.1M	0.0M
aih-tih-sc-3cac57-R1_A23WJ53LT4_1	643.4M	0.0M	0.0M	47.6M	3.7M	572.2M	286.1M	286.0M	286.1M	286.1M	291.0M	281.1M	570.1M	0.0M
aih-tih-sc-3e4d53-R1_A23WJ53LT4_1	527.5M	0.0M	0.0M	37.9M	2.9M	470.3M	235.3M	235.0M	235.2M	235.1M	240.4M	229.9M	468.9M	0.0M
aih-tih-sc-3eb8dd-R1_A23WJ53LT4_1	492.3M	0.0M	0.0M	49.9M	2.1M	418.5M	209.4M	209.2M	209.3M	209.3M	226.0M	192.6M	417.2M	0.0M
aih-tih-sc-408cca-R1_A23WJ53LT4_1	533.1M	0.0M	0.0M	34.3M	2.2M	481.7M	241.0M	240.7M	240.9M	240.9M	269.1M	212.7M	480.3M	0.0M
aih-tih-sc-41b5f1-R1_A23WJ53LT4_1	287.8M	0.0M	0.0M	26.5M	2.0M	249.5M	124.8M	124.7M	124.8M	124.7M	151.5M	98.0M	248.7M	0.0M
aih-tih-sc-431fe7-R1_A23WJ53LT4_1	446.6M	0.0M	0.0M	35.6M	2.7M	394.1M	197.2M	196.9M	197.1M	197.1M	238.6M	155.5M	393.0M	0.0M
aih-tih-sc-487f7f-R1_A23WJ53LT4_1	415.4M	0.0M	0.0M	35.9M	2.3M	363.4M	181.8M	181.6M	181.7M	181.7M	223.7M	139.7M	362.2M	0.0M
aih-tih-sc-488877-R1_A23WJ53LT4_1	635.5M	0.0M	0.0M	41.4M	2.6M	571.6M	285.9M	285.6M	285.8M	285.8M	320.4M	251.1M	569.5M	0.0M
aih-tih-sc-4c132f-R1_A23WJ53LT4_1	640.3M	0.0M	0.0M	44.0M	3.1M	575.0M	287.7M	287.3M	287.6M	287.4M	306.5M	268.5M	572.7M	0.0M
aih-tih-sc-4ca6a8-R1_A23WJ53LT4_1	633.3M	0.0M	0.0M	37.2M	2.9M	577.9M	289.1M	288.8M	289.1M	288.9M	267.1M	310.9M	575.6M	0.0M
aih-tih-sc-4d6599-R1_A23WJ53LT4_1	636.0M	0.0M	0.0M	39.5M	2.9M	576.6M	288.4M	288.1M	288.4M	288.2M	290.6M	285.9M	574.6M	0.0M
aih-tih-sc-4e749e-R1_A23WJ53LT4_1	642.1M	0.0M	0.0M	48.6M	3.3M	568.3M	284.3M	284.0M	284.2M	284.1M	303.3M	265.0M	566.5M	0.0M
aih-tih-sc-4fd42c-R1_A23WJ53LT4_1	636.4M	0.0M	0.0M	41.1M	2.6M	575.2M	287.7M	287.5M	287.7M	287.6M	274.7M	300.6M	573.4M	0.0M
aih-tih-sc-550807-R1_A23WJ53LT4_1	376.6M	0.0M	0.0M	28.2M	1.7M	335.6M	167.9M	167.7M	167.8M	167.8M	172.6M	163.1M	334.5M	0.0M
aih-tih-sc-55b175-R1_A23WJ53LT4_1	638.3M	0.0M	0.0M	43.5M	4.3M	570.4M	285.3M	285.1M	285.2M	285.2M	287.2M	283.2M	568.5M	0.0M
aih-tih-sc-560d56-R1_A23WJ53LT4_1	404.7M	0.0M	0.0M	34.3M	2.4M	355.4M	177.8M	177.5M	177.7M	177.7M	213.2M	142.2M	354.2M	0.0M
aih-tih-sc-58b830-R1_A23WJ53LT4_1	487.3M	0.0M	0.0M	42.0M	2.6M	426.7M	213.5M	213.2M	213.4M	213.3M	241.4M	185.3M	424.9M	0.0M
aih-tih-sc-5d3207-R1_A23WJ53LT4_1	343.5M	0.0M	0.0M	20.8M	1.7M	311.9M	156.0M	155.8M	156.0M	155.9M	161.5M	150.4M	310.8M	0.0M
aih-tih-sc-5e5452-R1_A23WJ53LT4_1	293.9M	0.0M	0.0M	23.3M	1.7M	259.9M	130.0M	129.8M	130.0M	129.9M	152.8M	107.0M	258.8M	0.0M
aih-tih-sc-606237-R1_A23WJ53LT4_1	635.2M	0.0M	0.0M	41.4M	2.6M	573.2M	286.7M	286.5M	286.6M	286.6M	271.2M	302.0M	571.5M	0.0M
aih-tih-sc-6064dc-R1_A23WJ53LT4_1	366.6M	0.0M	0.0M	29.2M	1.7M	325.0M	162.5M	162.4M	162.5M	162.5M	157.7M	167.3M	324.0M	0.0M
aih-tih-sc-64cace-R1_A23WJ53LT4_1	168.7M	0.0M	0.0M	9.7M	0.7M	154.1M	77.1M	77.0M	77.0M	77.0M	81.2M	72.9M	153.5M	0.0M
aih-tih-sc-669302-R1_A23WJ53LT4_1	650.5M	0.0M	0.0M	56.5M	2.7M	566.0M	283.1M	282.9M	283.0M	283.0M	285.9M	280.2M	564.6M	0.0M
aih-tih-sc-66e7f5-R1_A23WJ53LT4_1	458.0M	0.0M	0.0M	37.7M	2.5M	402.4M	201.3M	201.0M	201.2M	201.2M	236.2M	166.2M	401.0M	0.0M
aih-tih-sc-6734d6-R1_A23WJ53LT4_1	641.0M	0.0M	0.0M	45.9M	2.8M	573.5M	286.9M	286.6M	286.8M	286.7M	295.6M	277.9M	571.6M	0.0M
aih-tih-sc-674b78-R1_A23WJ53LT4_1	671.9M	0.0M	0.0M	77.1M	3.8M	556.6M	278.4M	278.2M	278.3M	278.3M	313.2M	243.4M	554.8M	0.0M
aih-tih-sc-6832bb-R1_A23WJ53LT4_1	630.4M	0.0M	0.0M	35.2M	2.5M	576.9M	288.6M	288.3M	288.5M	288.4M	290.3M	286.6M	574.6M	0.0M
aih-tih-sc-693ffe-R1_A23WJ53LT4_1	629.8M	0.0M	0.0M	51.7M	3.4M	557.1M	278.6M	278.4M	278.6M	278.5M	298.4M	258.6M	555.0M	0.0M
aih-tih-sc-6f889c-R1_A23WJ53LT4_1	288.7M	0.0M	0.0M	24.9M	1.7M	252.7M	126.4M	126.2M	126.4M	126.3M	138.6M	114.0M	251.7M	0.0M
aih-tih-sc-6fcd81-R1_A23WJ53LT4_1	652.0M	0.0M	0.0M	56.3M	4.8M	568.8M	284.5M	284.3M	284.5M	284.4M	303.3M	265.5M	566.8M	0.0M
aih-tih-sc-6ff823-R1_A23WJ53LT4_1	587.4M	0.0M	0.0M	42.8M	2.7M	525.4M	262.9M	262.6M	262.8M	262.6M	285.2M	240.2M	523.2M	0.0M
aih-tih-sc-7cc8a0-R1_A23WJ53LT4_1	631.8M	0.0M	0.0M	36.5M	2.9M	577.8M	289.1M	288.7M	289.0M	288.8M	282.1M	295.7M	576.0M	0.0M
aih-tih-sc-7d33b9-R1_A23WJ53LT4_1	637.4M	0.0M	0.0M	41.3M	3.2M	575.3M	287.8M	287.5M	287.7M	287.6M	303.5M	271.8M	573.5M	0.0M
aih-tih-sc-7de750-R1_A23WJ53LT4_1	644.8M	0.0M	0.0M	49.5M	3.5M	570.3M	285.3M	285.1M	285.2M	285.1M	304.3M	266.0M	568.5M	0.0M
aih-tih-sc-804b22-R1_A23WJ53LT4_1	583.2M	0.0M	0.0M	33.2M	2.8M	533.5M	266.9M	266.6M	266.8M	266.7M	256.6M	276.9M	531.6M	0.0M
aih-tih-sc-8353c5-R1_A23WJ53LT4_1	525.8M	0.0M	0.0M	35.4M	2.3M	472.8M	236.5M	236.3M	236.4M	236.4M	243.2M	229.6M	471.3M	0.0M
aih-tih-sc-835699-R1_A23WJ53LT4_1	644.9M	0.0M	0.0M	49.0M	3.7M	568.3M	284.3M	284.0M	284.2M	284.1M	303.9M	264.3M	566.3M	0.0M
aih-tih-sc-87d1a3-R1_A23WJ53LT4_1	654.0M	0.0M	0.0M	57.7M	2.8M	570.4M	285.3M	285.1M	285.2M	285.1M	303.0M	267.4M	568.2M	0.0M
aih-tih-sc-951f98-R1_A23WJ53LT4_1	639.2M	0.0M	0.0M	44.5M	3.8M	570.4M	285.3M	285.0M	285.2M	285.1M	294.7M	275.7M	568.5M	0.0M
aih-tih-sc-965752-R1_A23WJ53LT4_1	640.2M	0.0M	0.0M	44.3M	3.2M	574.6M	287.4M	287.1M	287.3M	287.2M	310.9M	263.7M	572.6M	0.0M
aih-tih-sc-96af5b-R1_A23WJ53LT4_1	650.0M	0.0M	0.0M	54.4M	3.3M	566.4M	283.3M	283.1M	283.2M	283.2M	297.5M	268.9M	564.5M	0.0M
aih-tih-sc-98fc22-R1_A23WJ53LT4_1	646.9M	0.0M	0.0M	51.4M	3.3M	569.4M	284.8M	284.6M	284.7M	284.7M	314.9M	254.5M	567.7M	0.0M
aih-tih-sc-9ab390-R1_A23WJ53LT4_1	566.9M	0.0M	0.0M	38.1M	2.9M	509.0M	254.6M	254.4M	254.5M	254.5M	279.8M	229.2M	507.1M	0.0M
aih-tih-sc-9be8d4-R1_A23WJ53LT4_1	634.0M	0.0M	0.0M	37.5M	3.5M	577.3M	288.8M	288.5M	288.7M	288.6M	301.5M	275.9M	575.1M	0.0M
aih-tih-sc-9ee8d4-R1_A23WJ53LT4_1	563.7M	0.0M	0.0M	37.4M	2.3M	508.3M	254.3M	254.0M	254.2M	254.1M	269.0M	239.4M	506.7M	0.0M
aih-tih-sc-9f6030-R1_A23WJ53LT4_1	575.3M	0.0M	0.0M	47.9M	3.5M	506.2M	253.3M	252.9M	253.2M	253.1M	298.7M	207.5M	504.7M	0.0M
aih-tih-sc-9faac1-R1_A23WJ53LT4_1	653.0M	0.0M	0.0M	58.6M	3.8M	564.5M	282.4M	282.1M	282.3M	282.2M	315.4M	249.1M	562.8M	0.0M
aih-tih-sc-9fb608-R1_A23WJ53LT4_1	641.2M	0.0M	0.0M	45.5M	3.6M	573.5M	286.8M	286.6M	286.8M	286.7M	308.6M	264.9M	571.7M	0.0M
aih-tih-sc-a19eaa-R1_A23WJ53LT4_1	632.8M	0.0M	0.0M	36.7M	3.1M	578.5M	289.4M	289.1M	289.4M	289.1M	282.1M	296.4M	576.2M	0.0M
aih-tih-sc-af602e-R1_A23WJ53LT4_1	629.6M	0.0M	0.0M	34.7M	2.6M	577.4M	288.9M	288.5M	288.8M	288.7M	284.2M	293.2M	575.3M	0.0M
aih-tih-sc-b107e7-R1_A23WJ53LT4_1	629.0M	0.0M	0.0M	33.4M	2.9M	579.5M	289.9M	289.6M	289.9M	289.6M	269.4M	310.1M	577.5M	0.0M
aih-tih-sc-b675f7-R1_A23WJ53LT4_1	633.4M	0.0M	0.0M	38.1M	2.8M	576.0M	288.1M	287.9M	288.0M	288.0M	287.5M	288.4M	573.9M	0.0M
aih-tih-sc-b7f13b-R1_A23WJ53LT4_1	634.4M	0.0M	0.0M	39.6M	2.9M	574.8M	287.5M	287.3M	287.4M	287.4M	295.0M	279.8M	573.1M	0.0M
aih-tih-sc-bec563-R1_A23WJ53LT4_1	636.7M	0.0M	0.0M	40.4M	3.0M	576.9M	288.6M	288.3M	288.5M	288.4M	286.5M	290.4M	574.9M	0.0M
aih-tih-sc-c8485b-R1_A23WJ53LT4_1	638.9M	0.0M	0.0M	44.4M	3.1M	573.1M	286.8M	286.4M	286.6M	286.5M	302.2M	270.9M	571.2M	0.0M
aih-tih-sc-cab2fc-R1_A23WJ53LT4_1	645.3M	0.0M	0.0M	50.8M	2.7M	571.8M	286.1M	285.8M	286.0M	285.9M	285.7M	286.1M	570.0M	0.0M
aih-tih-sc-cdd9d2-R1_A23WJ53LT4_1	636.8M	0.0M	0.0M	40.9M	2.7M	577.5M	288.9M	288.6M	288.8M	288.7M	267.3M	310.3M	575.7M	0.0M
aih-tih-sc-ce4cdc-R1_A23WJ53LT4_1	477.3M	0.0M	0.0M	34.8M	2.4M	425.5M	212.9M	212.6M	212.8M	212.7M	235.7M	189.8M	423.8M	0.0M
aih-tih-sc-ced210-R1_A23WJ53LT4_1	642.7M	0.0M	0.0M	46.9M	3.6M	572.2M	286.2M	285.9M	286.1M	286.0M	307.5M	264.7M	570.1M	0.0M
aih-tih-sc-cf89e7-R1_A23WJ53LT4_1	202.8M	0.0M	0.0M	18.1M	1.3M	176.2M	88.2M	88.0M	88.1M	88.1M	112.7M	63.5M	175.7M	0.0M
aih-tih-sc-d45d48-R1_A23WJ53LT4_1	414.4M	0.0M	0.0M	46.4M	2.6M	348.3M	174.3M	174.0M	174.1M	174.1M	202.3M	146.0M	347.3M	0.0M
aih-tih-sc-d64bdd-R1_A23WJ53LT4_1	557.5M	0.0M	0.0M	41.1M	2.5M	496.8M	248.5M	248.3M	248.4M	248.4M	259.4M	237.4M	495.4M	0.0M
aih-tih-sc-da460d-R1_A23WJ53LT4_1	627.3M	0.0M	0.0M	32.7M	2.9M	577.1M	288.7M	288.4M	288.6M	288.5M	284.4M	292.7M	574.9M	0.0M
aih-tih-sc-e33b0b-R1_A23WJ53LT4_1	639.9M	0.0M	0.0M	46.1M	2.8M	567.9M	284.1M	283.9M	284.0M	283.9M	296.6M	271.4M	566.5M	0.0M
aih-tih-sc-e4cfff-R1_A23WJ53LT4_1	583.3M	0.0M	0.0M	56.9M	3.4M	502.7M	251.5M	251.2M	251.4M	251.3M	278.2M	224.5M	501.1M	0.0M
aih-tih-sc-f29b4f-R1_A23WJ53LT4_1	401.6M	0.0M	0.0M	26.2M	1.9M	362.2M	181.2M	181.0M	181.1M	181.1M	193.0M	169.2M	361.0M	0.0M
aih-tih-sc-f2a1b0-R1_A23WJ53LT4_1	7.9M	0.0M	0.0M	1.4M	0.1M	5.9M	3.0M	3.0M	3.0M	3.0M	4.3M	1.6M	5.9M	0.0M
aih-tih-sc-fee548-R1_A23WJ53LT4_1	605.9M	0.0M	0.0M	39.2M	2.3M	544.7M	272.4M	272.3M	272.4M	272.3M	269.5M	275.2M	543.1M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	227325539	0.2152%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	394	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	395	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	3	144	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACATGCTTACTGATCTGGGG	2	120	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	59	0.0000%
TGAACCATTGAGCACTGCCTAATTCTTCTTAAAGTGGGAGGGCAGCACTT	2	6	0.0000%
GCTGCCGCTGGTGAGTCCCGGCGACTCCAGCAGGCTCCGGCCAGCCTCGC	2	5	0.0000%
CCCGCACCCAGTGGGGCATGGTGTGGGTGCTGGGGGAGCGGTGGTGCACA	2	5	0.0000%
GGGGAGAGAGAGAGAGAGAGGGCGCG	2	4	0.0000%
ACCGTCTTCCTGCTGCTCATCACTGAGATCATCCCGTCCACCTCGCTGGT	2	5	0.0000%
CGCGCCCTCTCTCTCTCTCTCTCCCC	2	4	0.0000%
GCGGCAACCGGCGCTGGGCGGCCGCTTGGACAGCCCGGGCAACCTCGACA	2	5	0.0000%
CCAGACAATGCCATCTTCACTCAGCGGGTAATTACGGGAACAATGGCTTT	2	5	0.0000%
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGGGGGG	2	209	0.0000%
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGGGGGGGGGG	1	1207	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGCTTACTGATCTGGG	1	47718	0.0000%
CGGAAGAGCACACGTCTGAACTCCAGTCACATGCTTACTGATCTGGGGGG	1	1879	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGCTTACTGATCTGGT	1	951	0.0000%
ATCGGAAGAGCACACGTCTGAACTCCAGTCACATGCTTACTGATCTGGGG	1	753	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	95163212	0.2001%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	195	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	85	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	197	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	59	0.0000%
TGAACCATTGAGCACTGCCTAATTCTTCTTAAAGTGGGAGGGCAGCACTT	2	6	0.0000%
GCTGCCGCTGGTGAGTCCCGGCGACTCCAGCAGGCTCCGGCCAGCCTCGC	2	5	0.0000%
CCCGCACCCAGTGGGGCATGGTGTGGGTGCTGGGGGAGCGGTGGTGCACA	2	5	0.0000%
GGGGAGAGAGAGAGAGAGAGGGCGCG	2	4	0.0000%
ACCGTCTTCCTGCTGCTCATCACTGAGATCATCCCGTCCACCTCGCTGGT	2	5	0.0000%
CGCGCCCTCTCTCTCTCTCTCTCCCC	2	4	0.0000%
GCGGCAACCGGCGCTGGGCGGCCGCTTGGACAGCCCGGGCAACCTCGACA	2	5	0.0000%
CCAGACAATGCCATCTTCACTCAGCGGGTAATTACGGGAACAATGGCTTT	2	5	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACATGCTTACTGATCTGGGG	1	60	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACATGCTTACTGATCTGGGG	1	39	0.0000%
GATCGGAAGAGCACACGTCTGACTCCAGTCACATGCTTACTGATCTGGGG	1	29	0.0000%
GCTGCCGGGGGGGCTGTAACACTCGGCAGC	1	26	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCGTCACATGCTTACTGATCTGGGG	1	22	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGCAGC	1	22	0.0000%
GATCGGAAAGAGCACACGTCTGAACTCCAGTCACATGCTTACTGATCTGG	1	17	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
RSEQC_TO_MULTIQC	python	`3.11.14`
	rseqc_to_multiqc	`1.0.0`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.14`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0019/A23WJ53LT4/nfcore_rnafusion__73d51683--20260607-225254' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0019_2-73d51683 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0041_A23WJ53LT4/' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0041_A23WJ53LT4/bclconvert_samplesheet.csv' --flowcell_id 20260515_LH00995_0041_A23WJ53LT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0019/A23WJ53LT4/nfcore_rnafusion__73d51683--20260607-225254'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0019_2-73d51683
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Skip steps

skip_picard_qc: true

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0019/A23WJ53LT4/nfcore_rnafusion__73d51683--20260607-225254
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0041_A23WJ53LT4/
flowcell_id: 20260515_LH00995_0041_A23WJ53LT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0041_A23WJ53LT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
arriba_gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir//ref_annot.gtf
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Mark Duplicates Help

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks