File Info

Filename
aih-tih-sc-d64bdd-R1_A23WJ53LT4_1.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/84/4c8ccf51e211adbdc77739db9f99bf/aih-tih-sc-d64bdd-R1_A23WJ53LT4_1.fastp.log
Size
1.6 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 260651228
total bases: 39358335428
Q20 bases: 38841050386(98.6857%)
Q30 bases: 37786709815(96.0069%)

Read2 before filtering:
total reads: 260651228
total bases: 39358335428
Q20 bases: 38722433455(98.3843%)
Q30 bases: 37364621905(94.9345%)

Read1 after filtering:
total reads: 257335897
total bases: 34257767992
Q20 bases: 34139413336(99.6545%)
Q30 bases: 33537201524(97.8966%)

Read2 after filtering:
total reads: 257335897
total bases: 34279789483
Q20 bases: 34059364159(99.357%)
Q30 bases: 33253867489(97.0072%)

Filtering result:
reads passed filter: 514671794
reads failed due to low quality: 6440940
reads failed due to too many N: 75236
reads failed due to too short: 114486
reads with adapter trimmed: 244799682
bases trimmed due to adapters: 9252309094

Duplication rate: 39.7079%

Insert size peak (evaluated by paired-end reads): 119

JSON report: aih-tih-sc-d64bdd-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-d64bdd-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-d64bdd-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-d64bdd-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-d64bdd-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-d64bdd-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-d64bdd-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-d64bdd-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 780 seconds