Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 175782762
total bases: 26543197062
Q20 bases: 26131802975(98.4501%)
Q30 bases: 25375349370(95.6002%)

Read2 before filtering:
total reads: 175782762
total bases: 26543197062
Q20 bases: 26120637200(98.408%)
Q30 bases: 25213426333(94.9902%)

Read1 after filtering:
total reads: 173544029
total bases: 22319799510
Q20 bases: 22241777527(99.6504%)
Q30 bases: 21852509720(97.9064%)

Read2 after filtering:
total reads: 173544029
total bases: 22337858527
Q20 bases: 22203327334(99.3977%)
Q30 bases: 21705949926(97.1711%)

Filtering result:
reads passed filter: 347088058
reads failed due to low quality: 4314030
reads failed due to too many N: 50132
reads failed due to too short: 113304
reads with adapter trimmed: 203232638
bases trimmed due to adapters: 7814775515

Duplication rate: 37.2149%

Insert size peak (evaluated by paired-end reads): 120

JSON report: aih-tih-sc-550807-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-550807-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-550807-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-550807-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-550807-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-550807-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-550807-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-550807-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 371 seconds