Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 93528621
total bases: 14122821771
Q20 bases: 13776554678(97.5482%)
Q30 bases: 13270565774(93.9654%)
Read2 before filtering:
total reads: 93528621
total bases: 14122821771
Q20 bases: 13828297352(97.9145%)
Q30 bases: 13231592745(93.6894%)
Read1 after filtering:
total reads: 92048174
total bases: 11021654307
Q20 bases: 10984585725(99.6637%)
Q30 bases: 10794904623(97.9427%)
Read2 after filtering:
total reads: 92048174
total bases: 11037708155
Q20 bases: 10966224444(99.3524%)
Q30 bases: 10708239940(97.0151%)
Filtering result:
reads passed filter: 184096348
reads failed due to low quality: 2536642
reads failed due to too many N: 24034
reads failed due to too short: 400218
reads with adapter trimmed: 130113306
bases trimmed due to adapters: 5794259833
Duplication rate: 51.6397%
Insert size peak (evaluated by paired-end reads): 108
JSON report: aih-tih-sc-cf89e7-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-cf89e7-R1_A23WJ53LT4_1.fastp.html
fastp --in1 aih-tih-sc-cf89e7-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-cf89e7-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-cf89e7-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-cf89e7-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-cf89e7-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-cf89e7-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 283 seconds