Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 162660737
total bases: 24561771287
Q20 bases: 24142625598(98.2935%)
Q30 bases: 23460264579(95.5154%)

Read2 before filtering:
total reads: 162660737
total bases: 24561771287
Q20 bases: 24158951105(98.36%)
Q30 bases: 23309684301(94.9023%)

Read1 after filtering:
total reads: 160696975
total bases: 20892886586
Q20 bases: 20825474267(99.6773%)
Q30 bases: 20471710847(97.9841%)

Read2 after filtering:
total reads: 160696975
total bases: 20908127256
Q20 bases: 20787104988(99.4212%)
Q30 bases: 20325968728(97.2156%)

Filtering result:
reads passed filter: 321393950
reads failed due to low quality: 3789800
reads failed due to too many N: 43768
reads failed due to too short: 93956
reads with adapter trimmed: 170077346
bases trimmed due to adapters: 6778840409

Duplication rate: 30.8308%

Insert size peak (evaluated by paired-end reads): 118

JSON report: aih-tih-sc-5d3207-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-5d3207-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-5d3207-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-5d3207-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-5d3207-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-5d3207-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-5d3207-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-5d3207-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 434 seconds