Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 170191648
total bases: 25698938848
Q20 bases: 25354475983(98.6596%)
Q30 bases: 24688397179(96.0678%)

Read2 before filtering:
total reads: 170191648
total bases: 25698938848
Q20 bases: 25301578586(98.4538%)
Q30 bases: 24440685851(95.1039%)

Read1 after filtering:
total reads: 168042511
total bases: 22329091357
Q20 bases: 22251925978(99.6544%)
Q30 bases: 21861688159(97.9068%)

Read2 after filtering:
total reads: 168042511
total bases: 22351043900
Q20 bases: 22207907168(99.3596%)
Q30 bases: 21695542493(97.0672%)

Filtering result:
reads passed filter: 336085022
reads failed due to low quality: 3982152
reads failed due to too many N: 49600
reads failed due to too short: 266522
reads with adapter trimmed: 164272140
bases trimmed due to adapters: 6122141209

Duplication rate: 61.2396%

Insert size peak (evaluated by paired-end reads): 120

JSON report: aih-tih-sc-6064dc-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-6064dc-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-6064dc-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-6064dc-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-6064dc-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-6064dc-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-6064dc-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-6064dc-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 469 seconds