Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44500190553(98.2344%)
Q30 bases: 43147870385(95.2492%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44569741598(98.388%)
Q30 bases: 42930227129(94.7687%)

Read1 after filtering:
total reads: 296945364
total bases: 37776266446
Q20 bases: 37641515027(99.6433%)
Q30 bases: 36974380949(97.8773%)

Read2 after filtering:
total reads: 296945364
total bases: 37803736272
Q20 bases: 37582854407(99.4157%)
Q30 bases: 36746532442(97.2034%)

Filtering result:
reads passed filter: 593890728
reads failed due to low quality: 5913032
reads failed due to too many N: 88584
reads failed due to too short: 107656
reads with adapter trimmed: 349481504
bases trimmed due to adapters: 14185261859

Duplication rate: 35.1342%

Insert size peak (evaluated by paired-end reads): 111

JSON report: aih-tih-sc-9be8d4-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-9be8d4-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-9be8d4-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-9be8d4-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-9be8d4-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-9be8d4-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-9be8d4-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-9be8d4-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 749 seconds