Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 231381103
total bases: 34938546553
Q20 bases: 34422886210(98.5241%)
Q30 bases: 33420651139(95.6555%)
Read2 before filtering:
total reads: 231381103
total bases: 34938546553
Q20 bases: 34331814929(98.2634%)
Q30 bases: 33046503234(94.5847%)
Read1 after filtering:
total reads: 228644343
total bases: 29215151328
Q20 bases: 29113537253(99.6522%)
Q30 bases: 28604193570(97.9088%)
Read2 after filtering:
total reads: 228644343
total bases: 29239383734
Q20 bases: 29059679444(99.3854%)
Q30 bases: 28402789122(97.1388%)
Filtering result:
reads passed filter: 457288686
reads failed due to low quality: 5183746
reads failed due to too many N: 63534
reads failed due to too short: 226240
reads with adapter trimmed: 269023535
bases trimmed due to adapters: 10673641606
Duplication rate: 51.7676%
Insert size peak (evaluated by paired-end reads): 120
JSON report: aih-tih-sc-00d05f-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-00d05f-R1_A23WJ53LT4_1.fastp.html
fastp --in1 aih-tih-sc-00d05f-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-00d05f-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-00d05f-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-00d05f-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-00d05f-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-00d05f-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 615 seconds