Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44670513649(98.6104%)
Q30 bases: 43418850429(95.8474%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44511377712(98.2591%)
Q30 bases: 42843297062(94.5768%)

Read1 after filtering:
total reads: 296232391
total bases: 39085293727
Q20 bases: 38950838091(99.656%)
Q30 bases: 38262922533(97.896%)

Read2 after filtering:
total reads: 296232391
total bases: 39108711663
Q20 bases: 38862205101(99.3697%)
Q30 bases: 37946379654(97.0279%)

Filtering result:
reads passed filter: 592464782
reads failed due to low quality: 7353522
reads failed due to too many N: 98380
reads failed due to too short: 83316
reads with adapter trimmed: 286357954
bases trimmed due to adapters: 11356174152

Duplication rate: 34.9207%

Insert size peak (evaluated by paired-end reads): 118

JSON report: aih-tih-sc-cab2fc-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-cab2fc-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-cab2fc-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-cab2fc-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-cab2fc-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-cab2fc-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-cab2fc-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-cab2fc-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 877 seconds