Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44650266862(98.5657%)
Q30 bases: 43443239942(95.9012%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44548395216(98.3408%)
Q30 bases: 42977352092(94.8727%)

Read1 after filtering:
total reads: 296163610
total bases: 39177141698
Q20 bases: 39046055307(99.6654%)
Q30 bases: 38377586901(97.9591%)

Read2 after filtering:
total reads: 296163610
total bases: 39201653827
Q20 bases: 38968242422(99.4046%)
Q30 bases: 38092155982(97.1698%)

Filtering result:
reads passed filter: 592327220
reads failed due to low quality: 7386520
reads failed due to too many N: 90102
reads failed due to too short: 196158
reads with adapter trimmed: 282870274
bases trimmed due to adapters: 11148936248

Duplication rate: 41.1319%

Insert size peak (evaluated by paired-end reads): 118

JSON report: aih-tih-sc-669302-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-669302-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-669302-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-669302-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-669302-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-669302-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-669302-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-669302-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 795 seconds