Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44450337309(98.1244%)
Q30 bases: 43044112737(95.0201%)
Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44404515013(98.0232%)
Q30 bases: 42645241112(94.1396%)
Read1 after filtering:
total reads: 296054044
total bases: 37316021068
Q20 bases: 37181812525(99.6403%)
Q30 bases: 36512855534(97.8477%)
Read2 after filtering:
total reads: 296054044
total bases: 37348132349
Q20 bases: 37122949753(99.3971%)
Q30 bases: 36284584931(97.1523%)
Filtering result:
reads passed filter: 592108088
reads failed due to low quality: 7673652
reads failed due to too many N: 90458
reads failed due to too short: 127802
reads with adapter trimmed: 360648719
bases trimmed due to adapters: 14862272921
Duplication rate: 39.2287%
Insert size peak (evaluated by paired-end reads): 109
JSON report: aih-tih-sc-da460d-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-da460d-R1_A23WJ53LT4_1.fastp.html
fastp --in1 aih-tih-sc-da460d-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-da460d-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-da460d-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-da460d-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-da460d-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-da460d-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 896 seconds