Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 211830011
total bases: 31986331661
Q20 bases: 31299577290(97.853%)
Q30 bases: 30189596627(94.3828%)

Read2 before filtering:
total reads: 211830011
total bases: 31986331661
Q20 bases: 31377494656(98.0966%)
Q30 bases: 30146466234(94.248%)

Read1 after filtering:
total reads: 209298258
total bases: 25571827144
Q20 bases: 25463748283(99.5774%)
Q30 bases: 24963586342(97.6214%)

Read2 after filtering:
total reads: 209298258
total bases: 25599261918
Q20 bases: 25457040266(99.4444%)
Q30 bases: 24924962394(97.3659%)

Filtering result:
reads passed filter: 418596516
reads failed due to low quality: 4676634
reads failed due to too many N: 54970
reads failed due to too short: 331902
reads with adapter trimmed: 286989871
bases trimmed due to adapters: 12125708867

Duplication rate: 49.9319%

Insert size peak (evaluated by paired-end reads): 108

JSON report: aih-tih-sc-66e7f5-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-66e7f5-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-66e7f5-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-66e7f5-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-66e7f5-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-66e7f5-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-66e7f5-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-66e7f5-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 663 seconds