Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44425858911(98.0703%)
Q30 bases: 42954148811(94.8215%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44560537848(98.3676%)
Q30 bases: 42905631128(94.7144%)

Read1 after filtering:
total reads: 296795392
total bases: 36587943993
Q20 bases: 36464480152(99.6626%)
Q30 bases: 35840345182(97.9567%)

Read2 after filtering:
total reads: 296795392
total bases: 36620921744
Q20 bases: 36418976734(99.4486%)
Q30 bases: 35652199727(97.3547%)

Filtering result:
reads passed filter: 593590784
reads failed due to low quality: 6154206
reads failed due to too many N: 79626
reads failed due to too short: 175384
reads with adapter trimmed: 389020588
bases trimmed due to adapters: 16531247511

Duplication rate: 33.8877%

Insert size peak (evaluated by paired-end reads): 109

JSON report: aih-tih-sc-87d1a3-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-87d1a3-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-87d1a3-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-87d1a3-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-87d1a3-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-87d1a3-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-87d1a3-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-87d1a3-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 945 seconds