Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44706015599(98.6888%)
Q30 bases: 43456545408(95.9306%)
Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44551067572(98.3467%)
Q30 bases: 42961467931(94.8377%)
Read1 after filtering:
total reads: 295966458
total bases: 39468513145
Q20 bases: 39321079373(99.6265%)
Q30 bases: 38594142859(97.7846%)
Read2 after filtering:
total reads: 295966458
total bases: 39491723488
Q20 bases: 39247600472(99.3818%)
Q30 bases: 38318142320(97.0283%)
Filtering result:
reads passed filter: 591932916
reads failed due to low quality: 7787614
reads failed due to too many N: 100370
reads failed due to too short: 179100
reads with adapter trimmed: 267397801
bases trimmed due to adapters: 10510288033
Duplication rate: 33.4737%
Insert size peak (evaluated by paired-end reads): 118
JSON report: aih-tih-sc-606237-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-606237-R1_A23WJ53LT4_1.fastp.html
fastp --in1 aih-tih-sc-606237-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-606237-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-606237-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-606237-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-606237-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-606237-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 818 seconds