Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44374729720(97.9575%)
Q30 bases: 42938526595(94.787%)
Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44509066979(98.254%)
Q30 bases: 42851035493(94.5939%)
Read1 after filtering:
total reads: 296070762
total bases: 36917001552
Q20 bases: 36787396552(99.6489%)
Q30 bases: 36144431050(97.9073%)
Read2 after filtering:
total reads: 296070762
total bases: 36952217760
Q20 bases: 36732439438(99.4052%)
Q30 bases: 35914341529(97.1913%)
Filtering result:
reads passed filter: 592141524
reads failed due to low quality: 7550394
reads failed due to too many N: 84304
reads failed due to too short: 223778
reads with adapter trimmed: 370302706
bases trimmed due to adapters: 15667704953
Duplication rate: 42.9806%
Insert size peak (evaluated by paired-end reads): 109
JSON report: aih-tih-sc-c8485b-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-c8485b-R1_A23WJ53LT4_1.fastp.html
fastp --in1 aih-tih-sc-c8485b-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-c8485b-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-c8485b-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-c8485b-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-c8485b-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-c8485b-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 849 seconds