Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 273830949
total bases: 41348473299
Q20 bases: 40392292751(97.6875%)
Q30 bases: 38969090065(94.2455%)

Read2 before filtering:
total reads: 273830949
total bases: 41348473299
Q20 bases: 40666292662(98.3502%)
Q30 bases: 39142442693(94.6648%)

Read1 after filtering:
total reads: 270961107
total bases: 32283362951
Q20 bases: 32165379864(99.6345%)
Q30 bases: 31600699035(97.8854%)

Read2 after filtering:
total reads: 270961107
total bases: 32315043197
Q20 bases: 32150889518(99.492%)
Q30 bases: 31515844962(97.5269%)

Filtering result:
reads passed filter: 541922214
reads failed due to low quality: 5490376
reads failed due to too many N: 69140
reads failed due to too short: 180168
reads with adapter trimmed: 403639093
bases trimmed due to adapters: 17340946387

Duplication rate: 46.3513%

Insert size peak (evaluated by paired-end reads): 109

JSON report: aih-tih-sc-6ff823-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-6ff823-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-6ff823-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-6ff823-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-6ff823-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-6ff823-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-6ff823-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-6ff823-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 642 seconds