Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44685771347(98.6441%)
Q30 bases: 43385375878(95.7735%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44605513084(98.4669%)
Q30 bases: 43054081678(95.0421%)

Read1 after filtering:
total reads: 296632708
total bases: 39137595293
Q20 bases: 38967579250(99.5656%)
Q30 bases: 38196442252(97.5953%)

Read2 after filtering:
total reads: 296632708
total bases: 39160022297
Q20 bases: 38922344688(99.3931%)
Q30 bases: 38038329299(97.1356%)

Filtering result:
reads passed filter: 593265416
reads failed due to low quality: 6504858
reads failed due to too many N: 89114
reads failed due to too short: 140612
reads with adapter trimmed: 300387369
bases trimmed due to adapters: 11365456807

Duplication rate: 38.0852%

Insert size peak (evaluated by paired-end reads): 120

JSON report: aih-tih-sc-2d4b78-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-2d4b78-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-2d4b78-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-2d4b78-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-2d4b78-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-2d4b78-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-2d4b78-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-2d4b78-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 829 seconds