Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44737562690(98.7584%)
Q30 bases: 43544655525(96.1251%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44612959394(98.4834%)
Q30 bases: 43116187469(95.1792%)

Read1 after filtering:
total reads: 296409979
total bases: 39458723504
Q20 bases: 39321195745(99.6515%)
Q30 bases: 38620021713(97.8745%)

Read2 after filtering:
total reads: 296409979
total bases: 39482273127
Q20 bases: 39247407814(99.4051%)
Q30 bases: 38358885780(97.1547%)

Filtering result:
reads passed filter: 592819958
reads failed due to low quality: 6948986
reads failed due to too many N: 90682
reads failed due to too short: 140374
reads with adapter trimmed: 284133470
bases trimmed due to adapters: 10654988612

Duplication rate: 40.5886%

Insert size peak (evaluated by paired-end reads): 118

JSON report: aih-tih-sc-b7f13b-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-b7f13b-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-b7f13b-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-b7f13b-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-b7f13b-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-b7f13b-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-b7f13b-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-b7f13b-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 770 seconds