Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44564928896(98.3773%)
Q30 bases: 43277259819(95.5348%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44467122072(98.1614%)
Q30 bases: 42750999918(94.3731%)

Read1 after filtering:
total reads: 295683184
total bases: 38414703536
Q20 bases: 38272826991(99.6307%)
Q30 bases: 37579054942(97.8247%)

Read2 after filtering:
total reads: 295683184
total bases: 38448259564
Q20 bases: 38186441085(99.319%)
Q30 bases: 37261009373(96.9121%)

Filtering result:
reads passed filter: 591366368
reads failed due to low quality: 8364956
reads failed due to too many N: 91334
reads failed due to too short: 177342
reads with adapter trimmed: 319319790
bases trimmed due to adapters: 12541740513

Duplication rate: 51.3609%

Insert size peak (evaluated by paired-end reads): 120

JSON report: aih-tih-sc-4e749e-R1_A23WJ53LT4_1.fastp.json
HTML report: aih-tih-sc-4e749e-R1_A23WJ53LT4_1.fastp.html

fastp --in1 aih-tih-sc-4e749e-R1_A23WJ53LT4_1_1.fastq.gz --in2 aih-tih-sc-4e749e-R1_A23WJ53LT4_1_2.fastq.gz --out1 aih-tih-sc-4e749e-R1_A23WJ53LT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-4e749e-R1_A23WJ53LT4_1_2.fastp.fastq.gz --json aih-tih-sc-4e749e-R1_A23WJ53LT4_1.fastp.json --html aih-tih-sc-4e749e-R1_A23WJ53LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 742 seconds