MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-21, 09:50 UTC based on data in: /tmp/nxf.5iwyn6OCVQ

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₂ columns.

Sample Name	Total Reads	Expected Distinct	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	RNA contaminated	RNA contamination %	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
659_6i-T1-TRNA-1_B23WHTKLT4_1	9999000000	54417571	385044116	0.01%	0.87%	51885988	0.82%	0.87%	0.13%	0.13%	42648633	21454637	6969430	3149941	66.08	30.00	0.50%	0.19%	0.98	0.000	129.6bp	122.0bp	0.01%	1.35%	0.40%	0.00%	0.01%	4.11%	0.63%	0.00%	No	0.00%				132bp	213bp	87.0%	0.0%	96.5%	88.7%	95.5%	183.9M	62.6%	97.5%	46078.3Mb	385.0M	54.7%	98.5%	70.5%
659_6i-T1-TRNA-1_B23WHTKLT4_1_1																																	129.6bp	97.6%	187.9M																89.3%	53%	151bp	151bp	18%	195.4M
659_6i-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.9%	54%	151bp	151bp	18%	195.4M
659_6i-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			89.4%	54%	123bp	127bp	9%	192.5M	89.4%	54%	123bp	127bp	9%	192.5M
659_6i-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			89.1%	54%	123bp	127bp	9%	192.5M	89.1%	54%	123bp	127bp	9%	192.5M
659_Dl-T1-TRNA-1_B23WHTKLT4_1	9999000000	40975613	300715434	0.01%	0.89%	32266285	0.77%	0.84%	0.16%	0.16%	24947277	12561194	5159792	2325539	40.34	16.00	0.36%	0.10%	0.97	0.000	136.2bp	127.0bp	0.01%	1.43%	0.42%	0.00%	0.01%	4.63%	0.71%	0.00%	No	0.00%				140bp	231bp	89.9%	0.0%	96.6%	85.1%	94.4%	141.9M	64.1%	97.3%	36615.5Mb	300.7M	56.1%	98.2%	65.5%
659_Dl-T1-TRNA-1_B23WHTKLT4_1_1																																	136.2bp	97.1%	146.0M																90.4%	55%	151bp	151bp	18%	153.1M
659_Dl-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.1%	55%	151bp	151bp	18%	153.1M
659_Dl-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			90.5%	55%	125bp	132bp	9%	150.4M	90.5%	55%	125bp	132bp	9%	150.4M
659_Dl-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			90.3%	56%	125bp	132bp	9%	150.4M	90.3%	56%	125bp	132bp	9%	150.4M
659_Lx-T1-TRNA-1_B23WHTKLT4_1	9999000000	94257245	496371104	0.00%	0.79%	102189153	0.90%	0.93%	0.08%	0.07%	91840320	46192853	8224644	3462018	147.84	60.00	0.61%	0.39%	0.98	0.000	129.6bp	120.0bp	0.01%	1.08%	0.36%	0.00%	0.01%	3.48%	0.60%	0.00%	No	0.00%				131bp	259bp	79.8%	0.0%	97.9%	90.7%	96.2%	238.7M	52.9%	97.5%	58285.3Mb	496.4M	54.3%	98.3%	70.6%
659_Lx-T1-TRNA-1_B23WHTKLT4_1_1																																	129.6bp	98.4%	244.2M																88.1%	53%	151bp	151bp	18%	252.5M
659_Lx-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.8%	54%	151bp	151bp	18%	252.5M
659_Lx-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.1%	54%	120bp	122bp	9%	248.2M	88.1%	54%	120bp	122bp	9%	248.2M
659_Lx-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			88.2%	54%	120bp	122bp	9%	248.2M	88.2%	54%	120bp	122bp	9%	248.2M
659_Mt-T1-TRNA-1_B23WHTKLT4_1	9999000000	46895114	329558042	0.01%	0.86%	44757569	0.83%	0.88%	0.13%	0.12%	37128638	18701127	5773680	2515349	62.59	24.00	0.46%	0.16%	0.97	0.000	140.1bp	129.0bp	0.00%	0.84%	0.30%	0.00%	0.01%	2.74%	0.50%	0.00%	No	0.00%				148bp	273bp	86.9%	0.0%	96.9%	86.5%	94.9%	156.3M	62.6%	97.4%	40636.0Mb	329.6M	55.1%	98.1%	61.4%
659_Mt-T1-TRNA-1_B23WHTKLT4_1_1																																	140.1bp	97.5%	160.6M																89.9%	54%	151bp	151bp	27%	167.9M
659_Mt-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.3%	55%	151bp	151bp	27%	167.9M
659_Mt-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			89.9%	54%	127bp	132bp	9%	164.8M	89.9%	54%	127bp	132bp	9%	164.8M
659_Mt-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			89.5%	55%	127bp	137bp	18%	164.8M	89.5%	55%	127bp	137bp	18%	164.8M
659_bCu-T1-TRNA-1_B23WHTKLT4_1	9999000000	16041081	134932238	0.01%	0.91%	12624538	0.72%	0.80%	0.20%	0.20%	9072505	4535875	2522077	1160273	13.35	3.00	0.10%	0.02%	0.97	0.000	121.9bp	113.0bp	0.00%	0.68%	0.24%	0.00%	0.00%	2.26%	0.40%	0.00%	No	0.00%				120bp	175bp	91.3%	0.0%	96.4%	86.6%	94.9%	64.1M	54.7%	97.2%	15230.1Mb	134.9M	59.2%	96.8%	74.6%
659_bCu-T1-TRNA-1_B23WHTKLT4_1_1																																	121.9bp	97.2%	65.6M																91.2%	57%	151bp	151bp	18%	69.7M
659_bCu-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.1%	58%	151bp	151bp	27%	69.7M
659_bCu-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			91.3%	59%	116bp	117bp	9%	67.5M	91.3%	59%	116bp	117bp	9%	67.5M
659_bCu-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			90.8%	59%	116bp	117bp	9%	67.5M	90.8%	59%	116bp	117bp	9%	67.5M
659_bGW-T1-TRNA-1_B23WHTKLT4_1	9990000000	112913439	591155012	0.00%	0.77%	138802913	0.92%	0.95%	0.06%	0.05%	127306728	64381008	8637808	3116318	232.05	87.00	0.65%	0.47%	0.97	0.000	143.8bp	131.0bp	0.01%	1.28%	0.66%	0.00%	0.02%	4.10%	0.98%	0.00%	No	0.00%				174bp	395bp	76.9%	0.0%	98.2%	88.9%	95.7%	282.7M	54.8%	97.4%	73795.2Mb	591.2M	56.9%	98.5%	58.4%
659_bGW-T1-TRNA-1_B23WHTKLT4_1_1																																	143.8bp	98.4%	291.0M																91.5%	55%	151bp	151bp	18%	470.6M
659_bGW-T1-TRNA-1_B23WHTKLT4_1_2																																																			90.1%	56%	151bp	151bp	18%	470.6M
659_bGW-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.9%	56%	128bp	137bp	9%	295.6M	88.9%	56%	128bp	137bp	9%	295.6M
659_bGW-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			88.8%	57%	128bp	137bp	9%	295.6M	88.8%	57%	128bp	137bp	9%	295.6M
659_bGc-T1-TRNA-1_B23WHTKLT4_1	9999000000	66524871	381979332	0.01%	0.82%	68115683	0.88%	0.92%	0.09%	0.08%	59743611	30129541	6298607	2574850	100.82	41.00	0.56%	0.28%	0.97	0.000	135.0bp	124.0bp	0.00%	0.97%	0.39%	0.00%	0.01%	2.94%	0.59%	0.00%	No	0.00%				143bp	287bp	82.6%	0.0%	97.3%	90.4%	96.1%	183.5M	55.0%	97.3%	45987.2Mb	382.0M	56.3%	98.2%	64.6%
659_bGc-T1-TRNA-1_B23WHTKLT4_1_1																																	135.0bp	98.1%	187.3M																88.5%	55%	151bp	151bp	18%	194.5M
659_bGc-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.9%	56%	151bp	151bp	18%	194.5M
659_bGc-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.5%	56%	124bp	127bp	9%	191.0M	88.5%	56%	124bp	127bp	9%	191.0M
659_bGc-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			88.2%	56%	124bp	132bp	9%	191.0M	88.2%	56%	124bp	132bp	9%	191.0M
659_bNS-T1-TRNA-1_B23WHTKLT4_1	9999000000	103263588	591123330	0.01%	0.82%	107953649	0.89%	0.94%	0.08%	0.06%	96327878	48883028	8611157	3115326	182.08	71.00	0.63%	0.43%	0.97	0.000	152.6bp	138.0bp	0.00%	1.46%	0.56%	0.00%	0.01%	4.36%	0.85%	0.00%	No	0.00%				203bp	508bp	82.2%	0.0%	97.7%	90.5%	96.1%	284.1M	59.9%	97.3%	75601.8Mb	591.1M	56.3%	98.5%	52.1%
659_bNS-T1-TRNA-1_B23WHTKLT4_1_1																																	152.6bp	98.3%	290.4M																91.0%	55%	151bp	151bp	18%	341.4M
659_bNS-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.6%	56%	151bp	151bp	18%	341.4M
659_bNS-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			90.3%	55%	131bp	147bp	9%	295.6M	90.3%	55%	131bp	147bp	9%	295.6M
659_bNS-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			90.1%	56%	131bp	147bp	9%	295.6M	90.1%	56%	131bp	147bp	9%	295.6M
659_bQZ-T1-TRNA-1_B23WHTKLT4_1	9999000000	87380240	547763984	0.01%	0.83%	94459755	0.88%	0.93%	0.08%	0.07%	82836670	41896859	7963890	3088648	150.44	58.00	0.61%	0.38%	0.97	0.000	145.5bp	133.0bp	0.00%	1.47%	0.57%	0.00%	0.01%	4.41%	0.88%	0.00%	No	0.00%				170bp	351bp	83.3%	0.0%	97.3%	88.5%	95.3%	261.1M	58.8%	97.3%	68543.3Mb	547.8M	57.3%	98.4%	57.7%
659_bQZ-T1-TRNA-1_B23WHTKLT4_1_1																																	145.5bp	97.9%	268.0M																89.7%	56%	151bp	151bp	18%	278.3M
659_bQZ-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.3%	57%	151bp	151bp	18%	278.3M
659_bQZ-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			89.8%	57%	129bp	137bp	9%	273.9M	89.8%	57%	129bp	137bp	9%	273.9M
659_bQZ-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			89.5%	57%	129bp	137bp	9%	273.9M	89.5%	57%	129bp	137bp	9%	273.9M
659_bTo-T1-TRNA-1_B23WHTKLT4_1	9990000000	147690500	592138810	0.00%	0.69%	182617198	0.93%	0.97%	0.05%	0.03%	170715679	86533649	9464490	2934670	346.83	116.00	0.66%	0.52%	0.97	0.000	160.7bp	146.0bp	0.00%	0.76%	0.68%	0.00%	0.01%	2.45%	1.02%	0.00%	No	0.00%				244bp	648bp	69.4%	0.0%	98.2%	92.5%	96.8%	286.7M	50.3%	97.2%	77136.3Mb	592.1M	56.0%	98.7%	47.7%
659_bTo-T1-TRNA-1_B23WHTKLT4_1_1																																	160.7bp	98.5%	291.8M																90.6%	55%	151bp	151bp	18%	434.3M
659_bTo-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.2%	56%	151bp	151bp	18%	434.3M
659_bTo-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.3%	55%	134bp	151bp	9%	296.1M	88.3%	55%	134bp	151bp	9%	296.1M
659_bTo-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			88.1%	56%	134bp	151bp	9%	296.1M	88.1%	56%	134bp	151bp	9%	296.1M
659_bUW-T1-TRNA-1_B23WHTKLT4_1	9999000000	176742679	592024030	0.00%	0.63%	218651297	0.94%	0.97%	0.05%	0.03%	205339768	104135090	10579144	3222233	420.57	149.00	0.67%	0.55%	0.97	0.000	159.6bp	143.0bp	0.01%	1.64%	0.66%	0.00%	0.01%	4.99%	0.99%	0.00%	No	0.00%				217bp	612bp	63.4%	0.0%	98.4%	86.1%	94.2%	278.9M	45.0%	97.4%	76672.6Mb	592.0M	54.3%	98.7%	48.9%
659_bUW-T1-TRNA-1_B23WHTKLT4_1_1																																	159.6bp	98.6%	291.8M																91.6%	53%	151bp	151bp	18%	617.4M
659_bUW-T1-TRNA-1_B23WHTKLT4_1_2																																																			90.7%	54%	151bp	151bp	18%	617.4M
659_bUW-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			87.3%	53%	133bp	151bp	9%	296.0M	87.3%	53%	133bp	151bp	9%	296.0M
659_bUW-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			87.7%	54%	133bp	151bp	9%	296.0M	87.7%	54%	133bp	151bp	9%	296.0M
659_bhK-T1-TRNA-1_B23WHTKLT4_1	9990000000	102556259	591740996	0.01%	0.78%	128606061	0.91%	0.95%	0.07%	0.05%	116717250	59223571	8884262	3113250	229.23	88.00	0.65%	0.48%	0.97	0.000	158.3bp	143.0bp	0.00%	0.68%	0.37%	0.00%	0.01%	2.53%	0.65%	0.00%	No	0.00%				240bp	608bp	78.7%	0.0%	97.6%	92.5%	96.8%	286.2M	57.0%	97.3%	76383.6Mb	591.7M	56.4%	98.6%	49.5%
659_bhK-T1-TRNA-1_B23WHTKLT4_1_1																																	158.3bp	98.3%	290.9M																92.1%	55%	151bp	151bp	18%	481.3M
659_bhK-T1-TRNA-1_B23WHTKLT4_1_2																																																			90.8%	56%	151bp	151bp	18%	481.3M
659_bhK-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			89.4%	56%	133bp	151bp	9%	295.9M	89.4%	56%	133bp	151bp	9%	295.9M
659_bhK-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			89.4%	56%	133bp	151bp	9%	295.9M	89.4%	56%	133bp	151bp	9%	295.9M
659_buD-T1-TRNA-1_B23WHTKLT4_1	9999000000	115250997	436345888	0.01%	0.67%	143877527	0.92%	0.95%	0.06%	0.05%	132409293	66883146	8942056	3318502	238.15	111.00	0.69%	0.52%	0.97	0.000	139.5bp	126.0bp	0.01%	1.19%	0.61%	0.00%	0.02%	3.67%	0.92%	0.00%	No	0.00%				161bp	376bp	67.4%	0.0%	97.6%	90.1%	95.9%	209.2M	44.1%	97.4%	53169.7Mb	436.3M	54.3%	98.3%	61.4%
659_buD-T1-TRNA-1_B23WHTKLT4_1_1																																	139.5bp	98.2%	214.3M																85.2%	53%	151bp	151bp	18%	221.9M
659_buD-T1-TRNA-1_B23WHTKLT4_1_2																																																			84.3%	54%	151bp	151bp	18%	221.9M
659_buD-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			85.2%	54%	125bp	132bp	9%	218.2M	85.2%	54%	125bp	132bp	9%	218.2M
659_buD-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			85.5%	54%	125bp	132bp	9%	218.2M	85.5%	54%	125bp	132bp	9%	218.2M
659_bua-T1-TRNA-1_B23WHTKLT4_1	9999000000	94528461	530013608	0.00%	0.81%	102407460	0.89%	0.93%	0.08%	0.07%	91379033	46232704	8569814	3336675	168.83	57.00	0.58%	0.39%	0.97	0.000	148.0bp	136.0bp	0.00%	0.71%	0.54%	0.00%	0.01%	2.33%	0.81%	0.00%	No	0.00%				182bp	419bp	81.1%	0.0%	97.3%	91.7%	96.5%	255.8M	57.9%	97.2%	67367.4Mb	530.0M	55.1%	98.7%	55.6%
659_bua-T1-TRNA-1_B23WHTKLT4_1_1																																	148.0bp	98.1%	260.1M																88.9%	54%	151bp	151bp	18%	268.6M
659_bua-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.5%	55%	151bp	151bp	18%	268.6M
659_bua-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			89.0%	54%	131bp	142bp	9%	265.0M	89.0%	54%	131bp	142bp	9%	265.0M
659_bua-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			88.6%	55%	131bp	142bp	9%	265.0M	88.6%	55%	131bp	142bp	9%	265.0M
659_c95-T1-TRNA-1_B23WHTKLT4_1	9990000000	175305185	591546962	0.01%	0.64%	210745899	0.93%	0.96%	0.06%	0.04%	195104396	98931905	12607303	4326747	383.03	175.00	0.71%	0.59%	0.97	0.000	154.4bp	139.0bp	0.01%	1.07%	0.46%	0.00%	0.01%	3.36%	0.69%	0.00%	Yes	0.00%				197bp	478bp	64.7%	0.0%	97.5%	89.3%	95.9%	283.5M	45.0%	97.4%	75365.8Mb	591.5M	54.7%	98.6%	52.0%
659_c95-T1-TRNA-1_B23WHTKLT4_1_1																																	154.4bp	97.9%	289.4M																87.3%	53%	151bp	151bp	18%	341.7M
659_c95-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.4%	54%	151bp	151bp	18%	341.7M
659_c95-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			86.4%	54%	131bp	147bp	9%	295.8M	86.4%	54%	131bp	147bp	9%	295.8M
659_c95-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			86.7%	55%	131bp	147bp	9%	295.8M	86.7%	55%	131bp	147bp	9%	295.8M
659_cAd-T1-TRNA-1_B23WHTKLT4_1	9999000000	83743981	589833654	0.01%	0.84%	93539989	0.86%	0.91%	0.10%	0.09%	80899663	40750889	9063935	3819907	132.18	48.00	0.58%	0.35%	0.98	0.000	132.5bp	123.0bp	0.01%	1.18%	0.69%	0.00%	0.01%	3.63%	1.05%	0.00%	No	0.00%				142bp	273bp	84.7%	0.0%	97.5%	89.3%	95.7%	282.1M	56.1%	97.4%	70848.0Mb	589.8M	55.8%	98.3%	66.5%
659_cAd-T1-TRNA-1_B23WHTKLT4_1_1																																	132.5bp	98.1%	289.2M																90.6%	55%	151bp	151bp	18%	321.2M
659_cAd-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.3%	55%	151bp	151bp	18%	321.2M
659_cAd-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			90.2%	55%	123bp	127bp	9%	294.9M	90.2%	55%	123bp	127bp	9%	294.9M
659_cAd-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			90.3%	56%	123bp	127bp	9%	294.9M	90.3%	56%	123bp	127bp	9%	294.9M
659_cIX-T1-TRNA-1_B23WHTKLT4_1	9999000000	108532177	591645764	0.00%	0.79%	127198019	0.90%	0.94%	0.08%	0.06%	114856230	58106363	9733068	3720167	216.06	78.00	0.63%	0.45%	0.98	0.000	149.1bp	136.0bp	0.00%	0.93%	0.52%	0.00%	0.01%	3.12%	0.81%	0.00%	No	0.00%				177bp	406bp	78.8%	0.0%	97.6%	91.7%	96.7%	285.9M	57.3%	97.4%	75005.6Mb	591.6M	55.9%	98.6%	55.1%
659_cIX-T1-TRNA-1_B23WHTKLT4_1_1																																	149.1bp	98.2%	290.5M																89.1%	54%	151bp	151bp	18%	308.3M
659_cIX-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.9%	55%	151bp	151bp	18%	308.3M
659_cIX-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			89.0%	55%	130bp	142bp	9%	295.8M	89.0%	55%	130bp	142bp	9%	295.8M
659_cIX-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			88.9%	56%	130bp	142bp	9%	295.8M	88.9%	56%	130bp	142bp	9%	295.8M
659_cRB-T1-TRNA-1_B23WHTKLT4_1	9999000000	72620135	487531190	0.01%	0.84%	76067949	0.86%	0.91%	0.10%	0.09%	65778109	33057420	7619103	3357796	101.50	42.00	0.56%	0.29%	0.98	0.000	121.1bp	114.0bp	0.01%	1.07%	0.62%	0.00%	0.02%	3.50%	0.97%	0.00%	No	0.00%				134bp	255bp	84.9%	0.0%	97.7%	89.7%	95.9%	233.7M	52.3%	97.5%	56050.3Mb	487.5M	55.8%	98.5%	75.6%
659_cRB-T1-TRNA-1_B23WHTKLT4_1_1																																	121.1bp	98.2%	239.5M																89.1%	54%	151bp	151bp	18%	247.4M
659_cRB-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.8%	55%	151bp	151bp	18%	247.4M
659_cRB-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			89.2%	55%	118bp	117bp	9%	243.8M	89.2%	55%	118bp	117bp	9%	243.8M
659_cRB-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			89.0%	55%	118bp	117bp	9%	243.8M	89.0%	55%	118bp	117bp	9%	243.8M
659_cRa-T1-TRNA-1_B23WHTKLT4_1	9999000000	113583989	591378242	0.01%	0.76%	142758407	0.91%	0.95%	0.06%	0.05%	130493662	66050906	9210298	3302349	256.02	110.00	0.68%	0.52%	0.97	0.000	151.3bp	137.0bp	0.00%	0.89%	0.49%	0.00%	0.01%	3.18%	0.81%	0.00%	No	0.00%				240bp	569bp	76.3%	0.0%	98.1%	91.7%	96.5%	285.4M	54.8%	97.3%	75711.6Mb	591.4M	56.4%	98.6%	52.0%
659_cRa-T1-TRNA-1_B23WHTKLT4_1_1																																	151.3bp	98.4%	290.9M																91.4%	55%	151bp	151bp	27%	444.4M
659_cRa-T1-TRNA-1_B23WHTKLT4_1_2																																																			90.1%	56%	151bp	151bp	27%	444.4M
659_cRa-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			89.2%	56%	131bp	147bp	18%	295.7M	89.2%	56%	131bp	147bp	18%	295.7M
659_cRa-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			89.0%	56%	132bp	147bp	18%	295.7M	89.0%	56%	132bp	147bp	18%	295.7M
659_cTi-T1-TRNA-1_B23WHTKLT4_1	9999000000	114690621	589901414	0.01%	0.76%	139722072	0.91%	0.95%	0.07%	0.05%	127104162	64219563	9215373	3416627	230.72	107.00	0.70%	0.52%	0.97	0.000	143.8bp	130.0bp	0.01%	0.94%	0.52%	0.00%	0.01%	2.95%	0.80%	0.00%	No	0.00%				178bp	441bp	76.8%	0.0%	97.9%	90.7%	96.0%	283.1M	52.9%	97.4%	73215.4Mb	589.9M	54.9%	98.3%	58.4%
659_cTi-T1-TRNA-1_B23WHTKLT4_1_1																																	143.8bp	98.2%	289.5M																90.2%	54%	151bp	151bp	18%	381.5M
659_cTi-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.7%	54%	151bp	151bp	18%	381.5M
659_cTi-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.7%	54%	127bp	137bp	9%	295.0M	88.7%	54%	127bp	137bp	9%	295.0M
659_cTi-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			88.7%	55%	127bp	137bp	9%	295.0M	88.7%	55%	127bp	137bp	9%	295.0M
659_cVw-T1-TRNA-1_B23WHTKLT4_1	9999000000	135868253	591131838	0.01%	0.72%	168455331	0.91%	0.95%	0.07%	0.05%	154034140	78222583	11096576	3701788	318.40	132.00	0.69%	0.55%	0.97	0.000	166.6bp	150.0bp	0.01%	1.20%	0.46%	0.00%	0.01%	3.92%	0.75%	0.00%	No	0.00%				216bp	509bp	71.9%	0.0%	97.5%	88.9%	95.5%	282.4M	53.2%	97.2%	77781.8Mb	591.1M	56.7%	98.5%	43.8%
659_cVw-T1-TRNA-1_B23WHTKLT4_1_1																																	166.6bp	98.0%	289.8M																89.8%	55%	151bp	151bp	18%	379.3M
659_cVw-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.1%	56%	151bp	151bp	18%	379.3M
659_cVw-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.3%	56%	135bp	151bp	9%	295.6M	88.3%	56%	135bp	151bp	9%	295.6M
659_cVw-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			87.8%	56%	135bp	151bp	9%	295.6M	87.8%	56%	135bp	151bp	9%	295.6M
659_cWx-T1-TRNA-1_B23WHTKLT4_1	9990000000	63730954	585762234	0.01%	0.89%	64828542	0.83%	0.90%	0.12%	0.10%	53709489	27145306	7748184	3064844	97.38	30.00	0.50%	0.25%	0.97	0.000	152.0bp	137.0bp	0.01%	1.19%	0.43%	0.00%	0.01%	3.77%	0.71%	0.00%	No	0.00%				180bp	345bp	89.4%	0.0%	96.7%	87.5%	95.2%	278.9M	65.0%	97.1%	74138.7Mb	585.8M	60.0%	97.9%	52.6%
659_cWx-T1-TRNA-1_B23WHTKLT4_1_1																																	152.0bp	97.5%	285.6M																92.3%	58%	151bp	151bp	18%	299.1M
659_cWx-T1-TRNA-1_B23WHTKLT4_1_2																																																			90.2%	59%	151bp	151bp	18%	299.1M
659_cWx-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			92.3%	59%	130bp	147bp	9%	292.9M	92.3%	59%	130bp	147bp	9%	292.9M
659_cWx-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			91.8%	60%	130bp	147bp	9%	292.9M	91.8%	60%	130bp	147bp	9%	292.9M
659_cfy-T1-TRNA-1_B23WHTKLT4_1	9990000000	132210027	591347052	0.00%	0.71%	172319676	0.93%	0.96%	0.06%	0.04%	159970853	80998394	9959238	3408673	311.57	117.00	0.67%	0.53%	0.97	0.000	153.2bp	139.0bp	0.01%	1.01%	0.65%	0.00%	0.02%	3.08%	0.94%	0.00%	No	0.00%				201bp	495bp	71.1%	0.0%	98.0%	91.8%	96.6%	285.6M	51.3%	97.3%	75719.1Mb	591.3M	56.4%	98.6%	52.2%
659_cfy-T1-TRNA-1_B23WHTKLT4_1_1																																	153.2bp	98.4%	290.9M																89.8%	55%	151bp	151bp	18%	412.3M
659_cfy-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.5%	56%	151bp	151bp	18%	412.3M
659_cfy-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			87.7%	56%	132bp	147bp	9%	295.7M	87.7%	56%	132bp	147bp	9%	295.7M
659_cfy-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			87.8%	56%	132bp	147bp	9%	295.7M	87.8%	56%	132bp	147bp	9%	295.7M
659_ciJ-T1-TRNA-1_B23WHTKLT4_1	9999000000	113263310	570791160	0.01%	0.74%	146509508	0.90%	0.95%	0.07%	0.05%	132441230	67339567	10756730	3681257	260.22	112.00	0.69%	0.52%	0.97	0.000	163.5bp	148.0bp	0.00%	0.86%	0.40%	0.00%	0.01%	2.69%	0.61%	0.00%	No	0.00%				202bp	456bp	74.8%	0.0%	96.8%	90.5%	96.0%	274.1M	55.1%	97.3%	74581.0Mb	570.8M	57.2%	98.5%	46.6%
659_ciJ-T1-TRNA-1_B23WHTKLT4_1_1																																	163.5bp	97.6%	278.7M																88.2%	56%	151bp	151bp	18%	289.8M
659_ciJ-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.9%	57%	151bp	151bp	18%	289.8M
659_ciJ-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.2%	56%	134bp	151bp	9%	285.4M	88.2%	56%	134bp	151bp	9%	285.4M
659_ciJ-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			88.0%	57%	134bp	151bp	9%	285.4M	88.0%	57%	134bp	151bp	9%	285.4M
659_ciZ-T1-TRNA-1_B23WHTKLT4_1	9999000000	79373975	590953388	0.00%	0.85%	86431534	0.87%	0.91%	0.10%	0.09%	75204389	37842082	8363482	3593935	117.40	45.00	0.57%	0.32%	0.98	0.000	125.3bp	117.0bp	0.01%	1.81%	0.69%	0.00%	0.01%	5.17%	1.03%	0.00%	No	0.00%				128bp	231bp	85.8%	0.0%	97.9%	88.6%	95.4%	281.9M	54.0%	97.4%	68434.6Mb	591.0M	54.7%	98.5%	74.1%
659_ciZ-T1-TRNA-1_B23WHTKLT4_1_1																																	125.3bp	98.3%	290.4M																90.7%	53%	151bp	151bp	18%	318.6M
659_ciZ-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.2%	54%	151bp	151bp	18%	318.6M
659_ciZ-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			90.4%	54%	119bp	122bp	9%	295.5M	90.4%	54%	119bp	122bp	9%	295.5M
659_ciZ-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			90.0%	54%	119bp	122bp	9%	295.5M	90.0%	54%	119bp	122bp	9%	295.5M
659_d01-T1-TRNA-1_B23WHTKLT4_1	9999000000	96219317	488765340	0.01%	0.80%	95337570	0.87%	0.92%	0.10%	0.08%	83415257	42157238	9265223	3736433	143.96	68.00	0.63%	0.42%	0.97	0.000	143.0bp	130.0bp	0.00%	1.01%	0.36%	0.00%	0.01%	3.26%	0.57%	0.00%	No	0.00%				150bp	265bp	80.9%	0.0%	96.2%	89.3%	95.8%	234.0M	55.5%	97.2%	60318.6Mb	488.8M	55.9%	98.1%	58.6%
659_d01-T1-TRNA-1_B23WHTKLT4_1_1																																	143.0bp	97.5%	238.3M																88.0%	55%	151bp	151bp	18%	249.1M
659_d01-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.5%	55%	151bp	151bp	18%	249.1M
659_d01-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.0%	55%	127bp	137bp	9%	244.4M	88.0%	55%	127bp	137bp	9%	244.4M
659_d01-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			87.9%	56%	127bp	137bp	9%	244.4M	87.9%	56%	127bp	137bp	9%	244.4M
659_dES-T1-TRNA-1_B23WHTKLT4_1	9999000000	123477522	592228976	0.01%	0.76%	139785128	0.89%	0.93%	0.08%	0.07%	124994666	63184180	11643606	4706129	228.13	103.00	0.67%	0.51%	0.98	0.000	146.4bp	134.0bp	0.01%	1.31%	0.38%	0.00%	0.01%	4.14%	0.65%	0.00%	No	0.00%				165bp	361bp	76.8%	0.0%	97.4%	89.0%	95.7%	283.2M	55.1%	97.5%	74895.0Mb	592.2M	53.7%	98.7%	57.1%
659_dES-T1-TRNA-1_B23WHTKLT4_1_1																																	146.4bp	98.0%	290.3M																89.0%	52%	151bp	151bp	18%	331.1M
659_dES-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.0%	53%	151bp	151bp	18%	331.1M
659_dES-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.3%	53%	130bp	142bp	9%	296.1M	88.3%	53%	130bp	142bp	9%	296.1M
659_dES-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			88.4%	53%	130bp	142bp	9%	296.1M	88.4%	53%	130bp	142bp	9%	296.1M
659_dc8-T1-TRNA-1_B23WHTKLT4_1	9999000000	93998467	588750708	0.01%	0.83%	101432330	0.88%	0.93%	0.09%	0.07%	89078926	45145507	9368034	3550037	166.78	74.00	0.64%	0.44%	0.97	0.000	153.0bp	138.0bp	0.01%	1.63%	0.47%	0.00%	0.02%	4.92%	0.74%	0.00%	No	0.00%				187bp	423bp	83.2%	0.0%	96.9%	89.5%	95.7%	281.8M	60.3%	97.4%	75128.3Mb	588.8M	56.0%	98.1%	51.7%
659_dc8-T1-TRNA-1_B23WHTKLT4_1_1																																	153.0bp	97.7%	287.6M																90.6%	55%	151bp	151bp	18%	312.2M
659_dc8-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.0%	55%	151bp	151bp	18%	312.2M
659_dc8-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			90.5%	55%	131bp	147bp	9%	294.4M	90.5%	55%	131bp	147bp	9%	294.4M
659_dc8-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			90.2%	56%	131bp	147bp	9%	294.4M	90.2%	56%	131bp	147bp	9%	294.4M
659_dcz-T1-TRNA-1_B23WHTKLT4_1	9999000000	15869757	95842054	0.01%	0.88%	11541198	0.72%	0.78%	0.21%	0.22%	8355873	4188498	2435400	1157885	11.41	4.00	0.09%	0.01%	0.98	0.000	117.5bp	112.0bp	0.01%	1.22%	0.27%	0.00%	0.01%	3.74%	0.47%	0.00%	No	0.00%				115bp	148bp	88.7%	0.0%	95.9%	85.1%	94.3%	45.2M	53.1%	97.4%	10686.3Mb	95.8M	55.3%	97.5%	80.9%
659_dcz-T1-TRNA-1_B23WHTKLT4_1_1																																	117.5bp	96.6%	46.3M																87.6%	54%	151bp	151bp	18%	49.2M
659_dcz-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.3%	55%	151bp	151bp	36%	49.2M
659_dcz-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			87.5%	55%	114bp	112bp	9%	47.9M	87.5%	55%	114bp	112bp	9%	47.9M
659_dcz-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			87.2%	55%	115bp	117bp	9%	47.9M	87.2%	55%	115bp	117bp	9%	47.9M
659_djb-T1-TRNA-1_B23WHTKLT4_1	9999000000	101248494	591967586	0.01%	0.80%	117243144	0.89%	0.92%	0.09%	0.08%	104025136	52464366	10254761	4285392	178.98	69.00	0.62%	0.43%	0.98	0.000	140.4bp	131.0bp	0.01%	1.72%	0.56%	0.00%	0.02%	5.20%	0.89%	0.00%	No	0.00%				163bp	367bp	80.6%	0.0%	97.6%	90.1%	96.0%	284.2M	57.7%	97.5%	73861.6Mb	592.0M	54.3%	98.7%	61.8%
659_djb-T1-TRNA-1_B23WHTKLT4_1_1																																	140.4bp	98.1%	290.4M																88.9%	53%	151bp	151bp	18%	301.9M
659_djb-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.9%	54%	151bp	151bp	18%	301.9M
659_djb-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.9%	54%	128bp	137bp	9%	296.0M	88.9%	54%	128bp	137bp	9%	296.0M
659_djb-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			89.0%	54%	128bp	137bp	9%	296.0M	89.0%	54%	128bp	137bp	9%	296.0M
659_dm4-T1-TRNA-1_B23WHTKLT4_1	9999000000	29157083	204320002	0.01%	0.89%	22896872	0.76%	0.82%	0.18%	0.18%	17368714	8712257	4215978	1968126	25.40	10.00	0.25%	0.04%	0.98	0.000	120.2bp	113.0bp	0.01%	1.25%	0.28%	0.00%	0.02%	3.80%	0.48%	0.00%	No	0.00%				117bp	155bp	89.4%	0.0%	96.1%	85.5%	94.6%	96.6M	54.5%	97.4%	23095.2Mb	204.3M	55.8%	98.0%	77.8%
659_dm4-T1-TRNA-1_B23WHTKLT4_1_1																																	120.2bp	97.2%	99.3M																89.5%	55%	151bp	151bp	18%	104.2M
659_dm4-T1-TRNA-1_B23WHTKLT4_1_2																																																			88.1%	55%	151bp	151bp	27%	104.2M
659_dm4-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			89.6%	55%	116bp	117bp	9%	102.2M	89.6%	55%	116bp	117bp	9%	102.2M
659_dm4-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			89.1%	55%	116bp	117bp	9%	102.2M	89.1%	55%	116bp	117bp	9%	102.2M
659_dts-T1-TRNA-1_B23WHTKLT4_1	9999000000	83343473	411607076	0.01%	0.77%	96486554	0.90%	0.94%	0.08%	0.06%	86844109	43784111	7247690	2884615	147.16	68.00	0.64%	0.41%	0.97	0.000	135.2bp	123.0bp	0.00%	0.90%	0.46%	0.00%	0.01%	2.82%	0.71%	0.00%	No	0.00%				143bp	285bp	77.0%	0.0%	97.5%	89.0%	95.5%	196.6M	50.1%	97.4%	49577.6Mb	411.6M	55.9%	98.3%	65.0%
659_dts-T1-TRNA-1_B23WHTKLT4_1_1																																	135.2bp	98.1%	201.9M																87.0%	54%	151bp	151bp	18%	209.5M
659_dts-T1-TRNA-1_B23WHTKLT4_1_2																																																			85.5%	55%	151bp	151bp	18%	209.5M
659_dts-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			87.0%	55%	124bp	127bp	9%	205.8M	87.0%	55%	124bp	127bp	9%	205.8M
659_dts-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			86.9%	56%	124bp	127bp	9%	205.8M	86.9%	56%	124bp	127bp	9%	205.8M
659_ecd-T1-TRNA-1_B23WHTKLT4_1	9999000000	189426589	592213586	0.00%	0.63%	216859066	0.93%	0.96%	0.06%	0.04%	201451090	102365147	12927003	4172367	419.26	187.00	0.73%	0.60%	0.97	0.000	165.8bp	149.0bp	0.01%	0.79%	0.35%	0.00%	0.01%	2.53%	0.54%	0.00%	No	0.00%				229bp	606bp	63.6%	0.0%	97.5%	91.0%	96.4%	285.3M	46.5%	97.3%	77973.8Mb	592.2M	54.9%	98.7%	44.2%
659_ecd-T1-TRNA-1_B23WHTKLT4_1_1																																	165.8bp	98.1%	290.4M																87.0%	54%	151bp	151bp	18%	334.2M
659_ecd-T1-TRNA-1_B23WHTKLT4_1_2																																																			86.1%	54%	151bp	151bp	18%	334.2M
659_ecd-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			86.2%	54%	135bp	151bp	9%	296.1M	86.2%	54%	135bp	151bp	9%	296.1M
659_ecd-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			86.4%	55%	135bp	151bp	9%	296.1M	86.4%	55%	135bp	151bp	9%	296.1M
659_epP-T1-TRNA-1_B23WHTKLT4_1	9990000000	89795818	590659730	0.01%	0.83%	100251628	0.88%	0.93%	0.09%	0.07%	88112494	44641405	8870408	3391829	163.45	68.00	0.62%	0.42%	0.97	0.000	151.9bp	138.0bp	0.00%	0.76%	0.36%	0.00%	0.01%	2.47%	0.58%	0.00%	No	0.00%				174bp	339bp	83.5%	0.0%	96.8%	86.9%	94.9%	280.3M	61.2%	97.3%	75408.2Mb	590.7M	57.5%	98.4%	53.1%
659_epP-T1-TRNA-1_B23WHTKLT4_1_1																																	151.9bp	97.8%	288.9M																90.6%	56%	151bp	151bp	18%	326.1M
659_epP-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.1%	57%	151bp	151bp	18%	326.1M
659_epP-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			90.2%	57%	131bp	147bp	9%	295.3M	90.2%	57%	131bp	147bp	9%	295.3M
659_epP-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			89.9%	57%	131bp	147bp	9%	295.3M	89.9%	57%	131bp	147bp	9%	295.3M
659_ezg-T1-TRNA-1_B23WHTKLT4_1	9999000000	114658524	591705022	0.01%	0.76%	140451982	0.91%	0.94%	0.07%	0.06%	127298073	64430891	10075991	3782142	237.16	99.00	0.66%	0.50%	0.97	0.000	149.7bp	137.0bp	0.01%	1.55%	0.61%	0.00%	0.01%	4.74%	0.94%	0.00%	No	0.00%				183bp	414bp	76.7%	0.0%	97.5%	89.4%	95.9%	283.6M	55.6%	97.4%	75452.7Mb	591.7M	55.9%	98.6%	54.9%
659_ezg-T1-TRNA-1_B23WHTKLT4_1_1																																	149.7bp	97.9%	289.6M																90.3%	55%	151bp	151bp	18%	403.5M
659_ezg-T1-TRNA-1_B23WHTKLT4_1_2																																																			89.2%	55%	151bp	151bp	18%	403.5M
659_ezg-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			88.4%	55%	131bp	142bp	9%	295.9M	88.4%	55%	131bp	142bp	9%	295.9M
659_ezg-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			88.5%	56%	131bp	142bp	9%	295.9M	88.5%	56%	131bp	142bp	9%	295.9M
659_gK-T1-TRNA-1_B23WHTKLT4_1	9999000000	74879347	370530330	0.00%	0.74%	94660136	0.91%	0.95%	0.07%	0.05%	85933238	43603839	6959788	2438904	167.46	63.00	0.60%	0.42%	0.97	0.000	158.8bp	143.0bp	0.01%	1.44%	0.48%	0.00%	0.02%	4.51%	0.76%	0.00%	No	0.00%				194bp	449bp	74.8%	0.0%	97.2%	88.3%	95.3%	176.5M	53.9%	97.3%	47750.8Mb	370.5M	55.2%	98.3%	48.8%
659_gK-T1-TRNA-1_B23WHTKLT4_1_1																																	158.8bp	98.0%	181.6M																86.9%	54%	151bp	151bp	18%	188.5M
659_gK-T1-TRNA-1_B23WHTKLT4_1_2																																																			85.5%	55%	151bp	151bp	18%	188.5M
659_gK-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			86.9%	54%	132bp	151bp	9%	185.3M	86.9%	54%	132bp	151bp	9%	185.3M
659_gK-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			86.8%	55%	132bp	151bp	9%	185.3M	86.8%	55%	132bp	151bp	9%	185.3M
659_rd-T1-TRNA-1_B23WHTKLT4_1	9990000000	161503317	591807916	0.00%	0.67%	192797695	0.92%	0.96%	0.06%	0.04%	177573775	90230562	12513618	4182124	368.11	151.00	0.71%	0.57%	0.97	0.000	167.6bp	151.0bp	0.00%	1.15%	0.29%	0.00%	0.00%	3.94%	0.49%	0.00%	No	0.00%				229bp	609bp	67.7%	0.0%	97.3%	92.2%	96.7%	286.0M	50.5%	97.3%	78232.2Mb	591.8M	54.7%	98.6%	43.8%
659_rd-T1-TRNA-1_B23WHTKLT4_1_1																																	167.6bp	98.0%	290.0M																88.1%	54%	151bp	151bp	18%	342.6M
659_rd-T1-TRNA-1_B23WHTKLT4_1_2																																																			87.0%	54%	151bp	151bp	18%	342.6M
659_rd-T1-TRNA-1_B23WHTKLT4_1_trimmed_1																																																			87.1%	54%	136bp	151bp	9%	295.9M	87.1%	54%	136bp	151bp	9%	295.9M
659_rd-T1-TRNA-1_B23WHTKLT4_1_trimmed_2																																																			87.2%	54%	136bp	151bp	9%	295.9M	87.2%	54%	136bp	151bp	9%	295.9M
FFPE_HD789_01_RNA_13_B23WHTKLT4_1	9999000000	534365456	592431644	0.00%	0.40%	352951210	0.95%	0.98%	0.05%	0.02%	334358760	169968559	15919028	4296954	751.57	304.00	0.72%	0.63%	0.97	0.000	180.2bp	164.0bp	0.01%	1.65%	0.69%	0.00%	0.01%	4.81%	0.98%	0.00%	Yes	62.74%				309bp	891bp	40.6%	0.0%	97.8%	91.3%	96.5%	285.8M	30.0%	97.3%	79890.0Mb	592.4M	54.8%	98.7%	37.3%
FFPE_HD789_01_RNA_13_B23WHTKLT4_1_1																																	180.2bp	98.1%	290.7M																87.6%	54%	151bp	151bp	18%	519.2M
FFPE_HD789_01_RNA_13_B23WHTKLT4_1_2																																																			86.8%	54%	151bp	151bp	18%	519.2M
FFPE_HD789_01_RNA_13_B23WHTKLT4_1_trimmed_1																																																			84.2%	54%	139bp	151bp	9%	296.2M	84.2%	54%	139bp	151bp	9%	296.2M
FFPE_HD789_01_RNA_13_B23WHTKLT4_1_trimmed_2																																																			84.7%	55%	139bp	151bp	9%	296.2M	84.7%	55%	139bp	151bp	9%	296.2M
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1	9990000000	287149576	591836756	0.01%	0.52%	282328251	0.93%	0.96%	0.06%	0.04%	262889947	133662307	15753484	4930012	550.34	136.00	0.60%	0.52%	0.97	0.000	165.5bp	150.0bp	0.01%	1.69%	1.04%	0.00%	0.01%	4.66%	1.44%	0.00%	No	0.00%				217bp	540bp	52.6%	0.0%	96.7%	89.4%	95.8%	283.4M	37.8%	97.3%	77696.0Mb	591.8M	55.1%	98.6%	44.9%
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1_1																																	165.5bp	96.9%	286.8M																85.9%	54%	151bp	151bp	18%	318.2M
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1_2																																																			85.2%	55%	151bp	151bp	18%	318.2M
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1_trimmed_1																																																			85.6%	54%	135bp	151bp	9%	295.9M	85.6%	54%	135bp	151bp	9%	295.9M
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1_trimmed_2																																																			85.9%	55%	135bp	151bp	9%	295.9M	85.9%	55%	135bp	151bp	9%	295.9M
NTC_0001_0001_B23WHTKLT4_1	9999000000	48139	53950	0.57%	0.26%	40048	0.01%	0.03%	0.22%	0.97%	257	135	8828	4270	0.00	0.00	0.00%	0.00%	0.89	0.000	90.2bp	31.0bp	0.00%	0.00%	0.04%	0.00%	0.00%	0.00%	0.08%	0.00%	Skipped	N/A%				48bp	62bp	60.5%	0.1%	21.7%	3.0%	10.0%	0.0M	67.3%	89.1%	5.1Mb	0.1M	66.5%	3.2%	50.6%
NTC_0001_0001_B23WHTKLT4_1_1																																	90.2bp	10.7%	0.0M																98.1%	73%	151bp	151bp	55%	0.8M
NTC_0001_0001_B23WHTKLT4_1_2																																																			97.0%	98%	151bp	151bp	55%	0.8M
NTC_0001_0001_B23WHTKLT4_1_trimmed_1																																																			58.6%	62%	106bp	112bp	55%	0.0M	58.6%	62%	106bp	112bp	55%	0.0M
NTC_0001_0001_B23WHTKLT4_1_trimmed_2																																																			61.7%	69%	107bp	112bp	55%	0.0M	61.7%	69%	107bp	112bp	55%	0.0M
tih_rna_sample_00087_B23WHTKLT4_1	9999000000	250073793	592593444	0.00%	0.55%	266865230	0.93%	0.96%	0.06%	0.04%	248793858	126079154	15196828	5304014	498.13	216.00	0.70%	0.60%	0.98	0.000	157.2bp	143.0bp	0.01%	1.54%	0.58%	0.00%	0.01%	4.81%	0.85%	0.00%	No	0.00%				194bp	463bp	55.2%	0.0%	96.9%	89.5%	95.8%	283.8M	39.1%	97.5%	76977.0Mb	592.6M	54.2%	98.8%	49.6%
tih_rna_sample_00087_B23WHTKLT4_1_1																																	157.2bp	98.1%	290.5M																88.2%	53%	151bp	151bp	18%	497.8M
tih_rna_sample_00087_B23WHTKLT4_1_2																																																			87.5%	54%	151bp	151bp	18%	497.8M
tih_rna_sample_00087_B23WHTKLT4_1_trimmed_1																																																			84.5%	53%	133bp	151bp	9%	296.3M	84.5%	53%	133bp	151bp	9%	296.3M
tih_rna_sample_00087_B23WHTKLT4_1_trimmed_2																																																			85.0%	54%	133bp	151bp	9%	296.3M	85.0%	54%	133bp	151bp	9%	296.3M
tih_rna_sample_00087_B23WHTKLT4_2	9999000000	424777658	592147620	0.01%	0.46%	318116697	0.94%	0.96%	0.05%	0.04%	298039777	150819635	17097146	6036670	586.50	261.00	0.71%	0.62%	0.97	0.000	149.8bp	137.0bp	0.01%	1.59%	0.60%	0.00%	0.01%	4.90%	0.87%	0.00%	No	0.00%				176bp	405bp	46.5%	0.0%	96.9%	89.1%	95.7%	283.2M	29.9%	97.2%	74965.9Mb	592.1M	54.0%	98.7%	53.8%
tih_rna_sample_00087_B23WHTKLT4_2_1																																	149.8bp	98.0%	290.2M																86.1%	53%	151bp	151bp	18%	441.5M
tih_rna_sample_00087_B23WHTKLT4_2_2																																																			85.4%	54%	151bp	151bp	18%	441.5M
tih_rna_sample_00087_B23WHTKLT4_2_trimmed_1																																																			83.4%	53%	130bp	142bp	9%	296.1M	83.4%	53%	130bp	142bp	9%	296.1M
tih_rna_sample_00087_B23WHTKLT4_2_trimmed_2																																																			83.8%	54%	130bp	147bp	9%	296.1M	83.8%	54%	130bp	147bp	9%	296.1M
tih_rna_sample_00089_B23WHTKLT4_1	9999000000	133957964	369624532	0.00%	0.58%	153613084	0.94%	0.96%	0.05%	0.04%	143850196	72847735	8196218	2775175	281.91	120.00	0.67%	0.53%	0.97	0.000	153.1bp	140.0bp	0.01%	1.38%	0.55%	0.00%	0.02%	4.26%	0.84%	0.00%	No	0.00%				192bp	453bp	58.7%	0.0%	97.2%	89.2%	95.9%	177.3M	39.1%	97.4%	47339.1Mb	369.6M	56.1%	98.7%	52.3%
tih_rna_sample_00089_B23WHTKLT4_1_1																																	153.1bp	98.2%	181.6M																83.0%	55%	151bp	151bp	18%	187.3M
tih_rna_sample_00089_B23WHTKLT4_1_2																																																			82.4%	55%	151bp	151bp	18%	187.3M
tih_rna_sample_00089_B23WHTKLT4_1_trimmed_1																																																			83.0%	55%	131bp	147bp	9%	184.8M	83.0%	55%	131bp	147bp	9%	184.8M
tih_rna_sample_00089_B23WHTKLT4_1_trimmed_2																																																			83.4%	56%	132bp	147bp	9%	184.8M	83.4%	56%	132bp	147bp	9%	184.8M
tih_rna_sample_00089_B23WHTKLT4_2	9999000000	248237384	591881508	0.00%	0.55%	263853974	0.94%	0.96%	0.05%	0.04%	247367128	125287314	13827313	4624528	487.82	219.00	0.72%	0.61%	0.97	0.000	152.7bp	139.0bp	0.01%	1.41%	0.56%	0.00%	0.02%	4.32%	0.85%	0.00%	No	0.00%				193bp	454bp	55.7%	0.0%	97.2%	89.2%	95.9%	283.8M	38.8%	97.3%	75697.4Mb	591.9M	56.0%	98.6%	52.1%
tih_rna_sample_00089_B23WHTKLT4_2_1																																	152.7bp	98.2%	290.5M																86.3%	55%	151bp	151bp	18%	364.2M
tih_rna_sample_00089_B23WHTKLT4_2_2																																																			85.7%	55%	151bp	151bp	18%	364.2M
tih_rna_sample_00089_B23WHTKLT4_2_trimmed_1																																																			84.8%	55%	131bp	147bp	9%	295.9M	84.8%	55%	131bp	147bp	9%	295.9M
tih_rna_sample_00089_B23WHTKLT4_2_trimmed_2																																																			85.4%	56%	131bp	147bp	9%	295.9M	85.4%	56%	131bp	147bp	9%	295.9M
tih_rna_sample_00090_B23WHTKLT4_1	9999000000	66987932	417753942	0.01%	0.83%	72574199	0.87%	0.92%	0.09%	0.08%	62945929	31683062	6854079	2916928	100.93	23.00	0.46%	0.25%	0.97	0.000	125.2bp	118.0bp	0.00%	1.23%	0.55%	0.00%	0.01%	3.56%	0.85%	0.00%	No	0.00%				130bp	210bp	83.2%	0.0%	97.2%	83.9%	94.1%	196.5M	51.1%	97.2%	48518.1Mb	417.8M	60.2%	98.3%	72.0%
tih_rna_sample_00090_B23WHTKLT4_1_1																																	125.2bp	97.6%	203.9M																88.9%	58%	151bp	151bp	18%	212.6M
tih_rna_sample_00090_B23WHTKLT4_1_2																																																			87.4%	59%	151bp	151bp	18%	212.6M
tih_rna_sample_00090_B23WHTKLT4_1_trimmed_1																																																			88.9%	60%	119bp	122bp	9%	208.9M	88.9%	60%	119bp	122bp	9%	208.9M
tih_rna_sample_00090_B23WHTKLT4_1_trimmed_2																																																			88.6%	60%	120bp	122bp	9%	208.9M	88.6%	60%	120bp	122bp	9%	208.9M
tih_rna_sample_00090_B23WHTKLT4_2	9999000000	104269065	588771970	0.01%	0.79%	121506860	0.89%	0.93%	0.08%	0.07%	107819132	54241234	9767519	4035728	172.44	44.00	0.55%	0.36%	0.97	0.000	129.0bp	120.0bp	0.01%	1.25%	0.56%	0.00%	0.01%	3.60%	0.85%	0.00%	No	0.00%				135bp	226bp	79.9%	0.0%	97.2%	84.5%	94.2%	277.3M	51.2%	97.2%	69711.2Mb	588.8M	59.7%	98.1%	69.5%
tih_rna_sample_00090_B23WHTKLT4_2_1																																	129.0bp	97.8%	287.8M																89.6%	58%	151bp	151bp	18%	334.5M
tih_rna_sample_00090_B23WHTKLT4_2_2																																																			88.0%	58%	151bp	151bp	18%	334.5M
tih_rna_sample_00090_B23WHTKLT4_2_trimmed_1																																																			88.9%	59%	122bp	127bp	9%	294.4M	88.9%	59%	122bp	127bp	9%	294.4M
tih_rna_sample_00090_B23WHTKLT4_2_trimmed_2																																																			88.8%	59%	122bp	127bp	9%	294.4M	88.8%	59%	122bp	127bp	9%	294.4M
tih_rna_sample_00096_B23WHTKLT4_1	9999000000	158211757	591755752	0.00%	0.68%	190270913	0.92%	0.95%	0.06%	0.05%	175190085	88795564	12260018	4367465	337.00	159.00	0.71%	0.58%	0.98	0.000	152.7bp	140.0bp	0.01%	0.70%	0.33%	0.00%	0.02%	2.18%	0.52%	0.00%	No	0.00%				177bp	387bp	68.2%	0.0%	97.0%	90.7%	96.3%	284.9M	49.0%	97.4%	75986.8Mb	591.8M	55.0%	98.6%	52.3%
tih_rna_sample_00096_B23WHTKLT4_1_1																																	152.7bp	98.0%	290.0M																87.0%	54%	151bp	151bp	18%	331.9M
tih_rna_sample_00096_B23WHTKLT4_1_2																																																			86.1%	54%	151bp	151bp	18%	331.9M
tih_rna_sample_00096_B23WHTKLT4_1_trimmed_1																																																			86.2%	54%	132bp	147bp	9%	295.9M	86.2%	54%	132bp	147bp	9%	295.9M
tih_rna_sample_00096_B23WHTKLT4_1_trimmed_2																																																			86.4%	55%	132bp	147bp	9%	295.9M	86.4%	55%	132bp	147bp	9%	295.9M
tih_rna_sample_00096_B23WHTKLT4_2	9990000000	226323730	591689958	0.00%	0.57%	252016605	0.93%	0.96%	0.06%	0.04%	235080801	119031762	14051122	4893025	454.91	224.00	0.74%	0.62%	0.97	0.000	150.6bp	138.0bp	0.01%	0.72%	0.34%	0.00%	0.02%	2.24%	0.52%	0.00%	No	0.00%				173bp	376bp	57.7%	0.0%	97.0%	90.7%	96.3%	284.8M	39.6%	97.4%	75278.6Mb	591.7M	54.7%	98.6%	53.8%
tih_rna_sample_00096_B23WHTKLT4_2_1																																	150.6bp	98.1%	290.1M																86.8%	53%	151bp	151bp	18%	400.2M
tih_rna_sample_00096_B23WHTKLT4_2_2																																																			85.7%	54%	151bp	151bp	18%	400.2M
tih_rna_sample_00096_B23WHTKLT4_2_trimmed_1																																																			84.5%	54%	131bp	142bp	9%	295.8M	84.5%	54%	131bp	142bp	9%	295.8M
tih_rna_sample_00096_B23WHTKLT4_2_trimmed_2																																																			84.7%	54%	131bp	147bp	9%	295.8M	84.7%	54%	131bp	147bp	9%	295.8M
tih_rna_sample_00097_B23WHTKLT4_1	9999000000	109769135	592137224	0.00%	0.77%	138025996	0.92%	0.95%	0.07%	0.05%	126375212	63755208	9098198	3576330	215.50	81.00	0.63%	0.46%	0.98	0.000	132.8bp	123.0bp	0.01%	2.34%	0.75%	0.00%	0.01%	6.29%	1.09%	0.00%	No	0.00%				155bp	377bp	77.0%	0.0%	97.8%	89.0%	95.7%	283.2M	50.5%	97.5%	71349.1Mb	592.1M	53.6%	98.7%	67.1%
tih_rna_sample_00097_B23WHTKLT4_1_1																																	132.8bp	98.3%	291.1M																90.6%	53%	151bp	151bp	18%	410.0M
tih_rna_sample_00097_B23WHTKLT4_1_2																																																			89.5%	53%	151bp	151bp	18%	410.0M
tih_rna_sample_00097_B23WHTKLT4_1_trimmed_1																																																			88.7%	53%	124bp	127bp	9%	296.1M	88.7%	53%	124bp	127bp	9%	296.1M
tih_rna_sample_00097_B23WHTKLT4_1_trimmed_2																																																			88.7%	53%	124bp	127bp	9%	296.1M	88.7%	53%	124bp	127bp	9%	296.1M
tih_rna_sample_00097_B23WHTKLT4_2	9999000000	134832103	590573458	0.00%	0.70%	175553039	0.93%	0.95%	0.06%	0.05%	162677752	81969454	10233714	3946478	273.65	107.00	0.66%	0.51%	0.98	0.000	128.2bp	119.0bp	0.01%	2.45%	0.77%	0.00%	0.02%	6.53%	1.12%	0.00%	No	0.00%				145bp	342bp	70.6%	0.0%	97.8%	88.6%	95.5%	282.0M	44.5%	97.4%	69627.5Mb	590.6M	53.3%	98.4%	69.6%
tih_rna_sample_00097_B23WHTKLT4_2_1																																	128.2bp	98.4%	290.5M																88.1%	52%	151bp	151bp	18%	339.3M
tih_rna_sample_00097_B23WHTKLT4_2_2																																																			86.8%	53%	151bp	151bp	18%	339.3M
tih_rna_sample_00097_B23WHTKLT4_2_trimmed_1																																																			87.3%	53%	121bp	122bp	9%	295.3M	87.3%	53%	121bp	122bp	9%	295.3M
tih_rna_sample_00097_B23WHTKLT4_2_trimmed_2																																																			87.2%	53%	121bp	122bp	9%	295.3M	87.2%	53%	121bp	122bp	9%	295.3M
tih_rna_sample_00116_B23WHTKLT4_1	9999000000	88617647	591507502	0.01%	0.84%	92863676	0.87%	0.92%	0.09%	0.08%	81127545	40852172	8362235	3533247	131.01	49.00	0.59%	0.34%	0.97	0.000	129.7bp	122.0bp	0.01%	1.32%	0.69%	0.00%	0.01%	3.72%	0.98%	0.00%	No	0.00%				137bp	259bp	84.8%	0.0%	97.7%	89.7%	95.8%	283.3M	56.0%	97.3%	70274.1Mb	591.5M	56.4%	98.6%	70.5%
tih_rna_sample_00116_B23WHTKLT4_1_1																																	129.7bp	97.8%	289.2M																90.6%	55%	151bp	151bp	18%	318.8M
tih_rna_sample_00116_B23WHTKLT4_1_2																																																			89.2%	56%	151bp	151bp	18%	318.8M
tih_rna_sample_00116_B23WHTKLT4_1_trimmed_1																																																			90.3%	56%	122bp	127bp	9%	295.8M	90.3%	56%	122bp	127bp	9%	295.8M
tih_rna_sample_00116_B23WHTKLT4_1_trimmed_2																																																			90.0%	56%	122bp	127bp	9%	295.8M	90.0%	56%	122bp	127bp	9%	295.8M
tih_rna_sample_00116_B23WHTKLT4_2	9999000000	119689967	558892094	0.01%	0.75%	142165708	0.91%	0.95%	0.07%	0.05%	129717519	65265095	9267858	3732657	209.21	85.00	0.66%	0.47%	0.97	0.000	127.3bp	119.0bp	0.01%	1.36%	0.71%	0.00%	0.01%	3.83%	1.00%	0.00%	No	0.00%				132bp	247bp	75.0%	0.0%	97.7%	89.6%	95.7%	267.4M	47.6%	97.4%	65510.1Mb	558.9M	56.0%	98.3%	71.9%
tih_rna_sample_00116_B23WHTKLT4_2_1																																	127.3bp	97.9%	273.6M																87.3%	54%	151bp	151bp	18%	284.2M
tih_rna_sample_00116_B23WHTKLT4_2_2																																																			86.1%	55%	151bp	151bp	18%	284.2M
tih_rna_sample_00116_B23WHTKLT4_2_trimmed_1																																																			87.3%	55%	120bp	122bp	9%	279.4M	87.3%	55%	120bp	122bp	9%	279.4M
tih_rna_sample_00116_B23WHTKLT4_2_trimmed_2																																																			87.3%	56%	120bp	122bp	9%	279.4M	87.3%	56%	120bp	122bp	9%	279.4M
tih_rna_sample_00121_B23WHTKLT4_1	9999000000	131150109	591553910	0.00%	0.73%	159934386	0.91%	0.95%	0.07%	0.05%	145912476	73832629	11121944	4199371	270.43	132.00	0.71%	0.55%	0.97	0.000	144.7bp	133.0bp	0.01%	0.89%	0.37%	0.00%	0.01%	2.89%	0.59%	0.00%	No	0.00%				165bp	342bp	73.3%	0.0%	96.9%	90.5%	96.1%	284.3M	50.1%	97.4%	73959.4Mb	591.6M	55.7%	98.6%	57.1%
tih_rna_sample_00121_B23WHTKLT4_1_1																																	144.7bp	98.0%	289.9M																87.3%	54%	151bp	151bp	18%	299.9M
tih_rna_sample_00121_B23WHTKLT4_1_2																																																			86.1%	55%	151bp	151bp	18%	299.9M
tih_rna_sample_00121_B23WHTKLT4_1_trimmed_1																																																			87.3%	55%	128bp	142bp	9%	295.8M	87.3%	55%	128bp	142bp	9%	295.8M
tih_rna_sample_00121_B23WHTKLT4_1_trimmed_2																																																			87.2%	55%	128bp	142bp	9%	295.8M	87.2%	55%	128bp	142bp	9%	295.8M
tih_rna_sample_00121_B23WHTKLT4_2	9999000000	231961606	592307678	0.01%	0.59%	242594588	0.93%	0.96%	0.06%	0.04%	226081906	114403844	13523261	4809847	435.41	225.00	0.75%	0.63%	0.98	0.000	148.2bp	136.0bp	0.01%	0.89%	0.37%	0.00%	0.01%	2.90%	0.60%	0.00%	No	0.00%				173bp	366bp	59.3%	0.0%	96.9%	90.6%	96.1%	284.7M	41.6%	97.4%	75435.1Mb	592.3M	55.5%	98.7%	54.5%
tih_rna_sample_00121_B23WHTKLT4_2_1																																	148.2bp	98.0%	290.3M																84.6%	54%	151bp	151bp	18%	303.7M
tih_rna_sample_00121_B23WHTKLT4_2_2																																																			83.9%	55%	151bp	151bp	18%	303.7M
tih_rna_sample_00121_B23WHTKLT4_2_trimmed_1																																																			84.5%	55%	131bp	142bp	9%	296.2M	84.5%	55%	131bp	142bp	9%	296.2M
tih_rna_sample_00121_B23WHTKLT4_2_trimmed_2																																																			84.8%	55%	131bp	142bp	9%	296.2M	84.8%	55%	131bp	142bp	9%	296.2M
tih_rna_sample_00124_B23WHTKLT4_1	9999000000	123288556	459190212	0.01%	0.69%	142198926	0.92%	0.95%	0.06%	0.05%	130550831	66052591	9051535	3345031	242.81	118.00	0.70%	0.53%	0.98	0.000	143.0bp	130.0bp	0.01%	0.98%	0.42%	0.00%	0.01%	3.18%	0.68%	0.00%	No	0.00%				173bp	383bp	69.4%	0.0%	97.0%	90.9%	96.2%	220.7M	48.1%	97.4%	57002.6Mb	459.2M	54.9%	98.6%	58.0%
tih_rna_sample_00124_B23WHTKLT4_1_1																																	143.0bp	97.9%	224.8M																85.8%	54%	151bp	151bp	18%	232.8M
tih_rna_sample_00124_B23WHTKLT4_1_2																																																			84.7%	54%	151bp	151bp	18%	232.8M
tih_rna_sample_00124_B23WHTKLT4_1_trimmed_1																																																			85.8%	54%	127bp	137bp	9%	229.6M	85.8%	54%	127bp	137bp	9%	229.6M
tih_rna_sample_00124_B23WHTKLT4_1_trimmed_2																																																			85.8%	55%	127bp	137bp	9%	229.6M	85.8%	55%	127bp	137bp	9%	229.6M
tih_rna_sample_00124_B23WHTKLT4_2	9999000000	177696333	450056268	0.01%	0.57%	191520383	0.93%	0.96%	0.05%	0.04%	178672028	90456414	10216835	3552072	345.68	176.00	0.73%	0.60%	0.98	0.000	150.2bp	137.0bp	0.01%	0.99%	0.41%	0.00%	0.01%	3.22%	0.67%	0.00%	No	0.00%				189bp	444bp	57.8%	0.0%	97.0%	91.2%	96.2%	216.5M	40.4%	97.5%	57544.2Mb	450.1M	54.3%	98.8%	53.6%
tih_rna_sample_00124_B23WHTKLT4_2_1																																	150.2bp	97.9%	220.3M																83.7%	53%	151bp	151bp	18%	227.9M
tih_rna_sample_00124_B23WHTKLT4_2_2																																																			83.0%	54%	151bp	151bp	18%	227.9M
tih_rna_sample_00124_B23WHTKLT4_2_trimmed_1																																																			83.8%	54%	131bp	147bp	9%	225.0M	83.8%	54%	131bp	147bp	9%	225.0M
tih_rna_sample_00124_B23WHTKLT4_2_trimmed_2																																																			84.0%	54%	131bp	147bp	9%	225.0M	84.0%	54%	131bp	147bp	9%	225.0M
tih_rna_sample_00136_B23WHTKLT4_1	9999000000	133355941	524588758	0.01%	0.71%	153802764	0.91%	0.94%	0.07%	0.06%	139999912	70827883	11133466	4301551	262.53	130.00	0.70%	0.55%	0.98	0.000	150.6bp	138.0bp	0.01%	1.46%	0.33%	0.00%	0.01%	4.69%	0.54%	0.00%	No	0.00%				164bp	329bp	71.0%	0.0%	96.8%	89.6%	95.8%	251.4M	50.5%	97.4%	66930.8Mb	524.6M	54.8%	98.7%	54.6%
tih_rna_sample_00136_B23WHTKLT4_1_1																																	150.6bp	97.9%	256.7M																86.0%	53%	151bp	151bp	18%	265.8M
tih_rna_sample_00136_B23WHTKLT4_1_2																																																			84.9%	54%	151bp	151bp	18%	265.8M
tih_rna_sample_00136_B23WHTKLT4_1_trimmed_1																																																			86.1%	54%	131bp	142bp	9%	262.3M	86.1%	54%	131bp	142bp	9%	262.3M
tih_rna_sample_00136_B23WHTKLT4_1_trimmed_2																																																			86.0%	55%	131bp	142bp	9%	262.3M	86.0%	55%	131bp	142bp	9%	262.3M
tih_rna_sample_00136_B23WHTKLT4_2	9999000000	180750571	531926546	0.01%	0.60%	211276327	0.92%	0.95%	0.06%	0.05%	195249518	98714307	13290358	5017381	367.83	187.00	0.74%	0.61%	0.98	0.000	146.4bp	134.0bp	0.01%	1.47%	0.33%	0.00%	0.01%	4.72%	0.55%	0.00%	No	0.00%				158bp	307bp	60.6%	0.0%	96.8%	89.3%	95.8%	254.7M	40.9%	97.4%	66962.3Mb	531.9M	55.2%	98.6%	56.6%
tih_rna_sample_00136_B23WHTKLT4_2_1																																	146.4bp	97.9%	260.4M																83.6%	54%	151bp	151bp	18%	269.7M
tih_rna_sample_00136_B23WHTKLT4_2_2																																																			82.6%	55%	151bp	151bp	18%	269.7M
tih_rna_sample_00136_B23WHTKLT4_2_trimmed_1																																																			83.6%	54%	129bp	142bp	9%	266.0M	83.6%	54%	129bp	142bp	9%	266.0M
tih_rna_sample_00136_B23WHTKLT4_2_trimmed_2																																																			83.7%	55%	129bp	142bp	9%	266.0M	83.7%	55%	129bp	142bp	9%	266.0M
tih_rna_sample_00145_B23WHTKLT4_1	9999000000	89596863	591470392	0.01%	0.84%	97456983	0.88%	0.93%	0.08%	0.07%	86158364	43402085	8058969	3341525	144.52	64.00	0.62%	0.40%	0.97	0.000	137.3bp	129.0bp	0.01%	0.86%	0.45%	0.00%	0.01%	2.69%	0.71%	0.00%	No	0.00%				159bp	340bp	84.0%	0.0%	97.3%	89.3%	95.6%	282.7M	60.4%	97.4%	73398.5Mb	591.5M	55.8%	98.6%	63.2%
tih_rna_sample_00145_B23WHTKLT4_1_1																																	137.3bp	98.3%	290.8M																90.7%	55%	151bp	151bp	18%	338.4M
tih_rna_sample_00145_B23WHTKLT4_1_2																																																			89.4%	55%	151bp	151bp	18%	338.4M
tih_rna_sample_00145_B23WHTKLT4_1_trimmed_1																																																			90.1%	55%	127bp	132bp	9%	295.7M	90.1%	55%	127bp	132bp	9%	295.7M
tih_rna_sample_00145_B23WHTKLT4_1_trimmed_2																																																			89.9%	55%	127bp	132bp	9%	295.7M	89.9%	55%	127bp	132bp	9%	295.7M
tih_rna_sample_00145_B23WHTKLT4_2	9999000000	128675402	582906764	0.01%	0.73%	158287236	0.92%	0.95%	0.06%	0.05%	144932417	72980006	10161112	4104214	240.12	112.00	0.69%	0.52%	0.98	0.000	127.4bp	118.0bp	0.01%	0.91%	0.46%	0.00%	0.02%	2.79%	0.74%	0.00%	No	0.00%				138bp	266bp	73.2%	0.0%	97.4%	88.6%	95.4%	278.1M	46.4%	97.4%	68679.4Mb	582.9M	56.2%	98.5%	70.3%
tih_rna_sample_00145_B23WHTKLT4_2_1																																	127.4bp	98.3%	286.6M																87.0%	54%	151bp	151bp	18%	295.8M
tih_rna_sample_00145_B23WHTKLT4_2_2																																																			86.0%	55%	151bp	151bp	18%	295.8M
tih_rna_sample_00145_B23WHTKLT4_2_trimmed_1																																																			87.0%	55%	121bp	122bp	9%	291.5M	87.0%	55%	121bp	122bp	9%	291.5M
tih_rna_sample_00145_B23WHTKLT4_2_trimmed_2																																																			87.2%	56%	121bp	122bp	9%	291.5M	87.2%	56%	121bp	122bp	9%	291.5M
tih_rna_sample_00146_B23WHTKLT4_1	9990000000	165858801	591862464	0.01%	0.66%	199634375	0.92%	0.96%	0.06%	0.04%	184307072	93690748	12212629	3933481	378.27	186.00	0.73%	0.61%	0.97	0.000	166.2bp	151.0bp	0.00%	0.53%	0.39%	0.00%	0.01%	1.76%	0.62%	0.00%	No	0.00%				229bp	563bp	66.6%	0.0%	96.9%	91.6%	96.5%	285.5M	47.6%	97.3%	78354.9Mb	591.9M	55.7%	98.6%	43.5%
tih_rna_sample_00146_B23WHTKLT4_1_1																																	166.2bp	97.8%	289.3M																87.4%	55%	151bp	151bp	18%	325.3M
tih_rna_sample_00146_B23WHTKLT4_1_2																																																			86.5%	55%	151bp	151bp	18%	325.3M
tih_rna_sample_00146_B23WHTKLT4_1_trimmed_1																																																			86.9%	55%	136bp	151bp	9%	295.9M	86.9%	55%	136bp	151bp	9%	295.9M
tih_rna_sample_00146_B23WHTKLT4_1_trimmed_2																																																			87.0%	56%	136bp	151bp	9%	295.9M	87.0%	56%	136bp	151bp	9%	295.9M
tih_rna_sample_00146_B23WHTKLT4_2	9999000000	243144115	592219408	0.01%	0.56%	263473857	0.93%	0.97%	0.05%	0.03%	246080486	125002338	14302373	4520193	504.49	257.00	0.76%	0.65%	0.97	0.000	162.0bp	145.0bp	0.01%	0.56%	0.39%	0.00%	0.01%	1.83%	0.62%	0.00%	No	0.00%				216bp	523bp	55.8%	0.0%	96.8%	91.4%	96.5%	285.6M	39.5%	97.3%	76997.8Mb	592.2M	55.6%	98.7%	46.7%
tih_rna_sample_00146_B23WHTKLT4_2_1																																	162.0bp	97.8%	289.4M																87.2%	54%	151bp	151bp	18%	399.3M
tih_rna_sample_00146_B23WHTKLT4_2_2																																																			86.4%	55%	151bp	151bp	18%	399.3M
tih_rna_sample_00146_B23WHTKLT4_2_trimmed_1																																																			85.1%	55%	134bp	151bp	9%	296.1M	85.1%	55%	134bp	151bp	9%	296.1M
tih_rna_sample_00146_B23WHTKLT4_2_trimmed_2																																																			85.4%	55%	134bp	151bp	9%	296.1M	85.4%	55%	134bp	151bp	9%	296.1M
tih_rna_sample_00149_B23WHTKLT4_1	9999000000	102945208	465710252	0.00%	0.73%	123867653	0.91%	0.94%	0.07%	0.06%	112544518	56807109	9201875	3699496	196.20	87.00	0.65%	0.47%	0.98	0.000	137.3bp	127.0bp	0.01%	0.94%	0.35%	0.00%	0.02%	2.91%	0.57%	0.00%	No	0.00%				147bp	286bp	73.7%	0.0%	96.8%	90.2%	96.0%	223.5M	50.3%	97.4%	57431.8Mb	465.7M	54.0%	98.6%	62.8%
tih_rna_sample_00149_B23WHTKLT4_1_1																																	137.3bp	98.0%	228.1M																86.3%	53%	151bp	151bp	18%	236.2M
tih_rna_sample_00149_B23WHTKLT4_1_2																																																			85.4%	54%	151bp	151bp	18%	236.2M
tih_rna_sample_00149_B23WHTKLT4_1_trimmed_1																																																			86.3%	53%	127bp	132bp	9%	232.9M	86.3%	53%	127bp	132bp	9%	232.9M
tih_rna_sample_00149_B23WHTKLT4_1_trimmed_2																																																			86.4%	54%	127bp	132bp	9%	232.9M	86.4%	54%	127bp	132bp	9%	232.9M
tih_rna_sample_00149_B23WHTKLT4_2	9999000000	165641871	502762086	0.00%	0.63%	184386317	0.92%	0.95%	0.06%	0.05%	170488283	86064025	11630717	4540918	303.58	140.00	0.70%	0.56%	0.98	0.000	138.8bp	129.0bp	0.01%	0.95%	0.36%	0.00%	0.02%	2.93%	0.57%	0.00%	No	0.00%				148bp	289bp	63.6%	0.0%	96.8%	90.1%	96.0%	241.3M	43.4%	97.4%	62239.1Mb	502.8M	54.0%	98.7%	62.4%
tih_rna_sample_00149_B23WHTKLT4_2_1																																	138.8bp	97.9%	246.1M																84.2%	53%	151bp	151bp	18%	254.7M
tih_rna_sample_00149_B23WHTKLT4_2_2																																																			83.4%	54%	151bp	151bp	18%	254.7M
tih_rna_sample_00149_B23WHTKLT4_2_trimmed_1																																																			84.3%	53%	127bp	132bp	9%	251.4M	84.3%	53%	127bp	132bp	9%	251.4M
tih_rna_sample_00149_B23WHTKLT4_2_trimmed_2																																																			84.4%	54%	127bp	132bp	9%	251.4M	84.4%	54%	127bp	132bp	9%	251.4M
tih_rna_sample_00150_B23WHTKLT4_1	9999000000	143952144	495361284	0.00%	0.65%	173073795	0.93%	0.96%	0.06%	0.04%	161035429	81462970	9873565	3464532	300.38	116.00	0.67%	0.53%	0.98	0.000	146.2bp	133.0bp	0.01%	1.24%	0.54%	0.00%	0.02%	3.45%	0.75%	0.00%	No	0.00%				172bp	457bp	65.3%	0.0%	97.6%	91.4%	96.5%	238.9M	44.7%	97.5%	62010.8Mb	495.4M	54.1%	98.5%	57.2%
tih_rna_sample_00150_B23WHTKLT4_1_1																																	146.2bp	98.2%	243.3M																86.2%	53%	151bp	151bp	18%	251.5M
tih_rna_sample_00150_B23WHTKLT4_1_2																																																			85.3%	54%	151bp	151bp	18%	251.5M
tih_rna_sample_00150_B23WHTKLT4_1_trimmed_1																																																			86.2%	53%	128bp	137bp	9%	247.7M	86.2%	53%	128bp	137bp	9%	247.7M
tih_rna_sample_00150_B23WHTKLT4_1_trimmed_2																																																			86.4%	54%	128bp	142bp	9%	247.7M	86.4%	54%	128bp	142bp	9%	247.7M
tih_rna_sample_00150_B23WHTKLT4_2	9990000000	250393615	592009200	0.00%	0.55%	266113906	0.94%	0.97%	0.05%	0.03%	250023772	126573166	13411981	4505588	481.35	194.00	0.72%	0.60%	0.98	0.000	146.6bp	134.0bp	0.01%	1.25%	0.54%	0.00%	0.03%	3.46%	0.75%	0.00%	No	0.00%				175bp	467bp	55.3%	0.0%	97.7%	91.3%	96.5%	285.5M	37.2%	97.5%	74609.0Mb	592.0M	54.5%	98.7%	56.4%
tih_rna_sample_00150_B23WHTKLT4_2_1																																	146.6bp	98.2%	290.7M																87.0%	53%	151bp	151bp	18%	390.3M
tih_rna_sample_00150_B23WHTKLT4_2_2																																																			86.2%	54%	151bp	151bp	18%	390.3M
tih_rna_sample_00150_B23WHTKLT4_2_trimmed_1																																																			85.1%	54%	129bp	142bp	9%	296.0M	85.1%	54%	129bp	142bp	9%	296.0M
tih_rna_sample_00150_B23WHTKLT4_2_trimmed_2																																																			85.4%	54%	129bp	142bp	9%	296.0M	85.4%	54%	129bp	142bp	9%	296.0M
tih_rna_sample_00158_B23WHTKLT4_1	9999000000	73716861	442961900	0.01%	0.83%	76831363	0.87%	0.93%	0.09%	0.07%	67124514	34047158	7145995	2730134	127.53	48.00	0.58%	0.34%	0.97	0.000	154.7bp	141.0bp	0.02%	1.41%	0.52%	0.00%	0.04%	4.10%	0.78%	0.00%	No	0.00%				179bp	378bp	83.1%	0.0%	97.1%	87.5%	95.1%	210.6M	61.4%	97.3%	56966.9Mb	443.0M	58.1%	98.5%	51.0%
tih_rna_sample_00158_B23WHTKLT4_1_1																																	154.7bp	97.7%	216.4M																89.7%	57%	151bp	151bp	18%	224.8M
tih_rna_sample_00158_B23WHTKLT4_1_2																																																			88.2%	57%	151bp	151bp	18%	224.8M
tih_rna_sample_00158_B23WHTKLT4_1_trimmed_1																																																			89.8%	57%	132bp	147bp	9%	221.5M	89.8%	57%	132bp	147bp	9%	221.5M
tih_rna_sample_00158_B23WHTKLT4_1_trimmed_2																																																			89.3%	58%	132bp	147bp	9%	221.5M	89.3%	58%	132bp	147bp	9%	221.5M
tih_rna_sample_00158_B23WHTKLT4_2	9999000000	79587493	319843414	0.01%	0.69%	97824024	0.91%	0.95%	0.07%	0.05%	89128358	45125099	6842053	2468066	167.97	66.00	0.62%	0.42%	0.97	0.000	149.7bp	135.0bp	0.03%	1.45%	0.53%	0.00%	0.05%	4.19%	0.78%	0.00%	No	0.00%				170bp	355bp	69.8%	0.0%	97.0%	87.1%	95.0%	151.9M	47.8%	97.2%	40267.5Mb	319.8M	57.9%	98.1%	53.7%
tih_rna_sample_00158_B23WHTKLT4_2_1																																	149.7bp	97.8%	156.3M																85.0%	56%	151bp	151bp	18%	163.0M
tih_rna_sample_00158_B23WHTKLT4_2_2																																																			83.9%	57%	151bp	151bp	18%	163.0M
tih_rna_sample_00158_B23WHTKLT4_2_trimmed_1																																																			85.0%	57%	129bp	142bp	9%	159.9M	85.0%	57%	129bp	142bp	9%	159.9M
tih_rna_sample_00158_B23WHTKLT4_2_trimmed_2																																																			85.2%	58%	130bp	142bp	9%	159.9M	85.2%	58%	130bp	142bp	9%	159.9M
tih_rna_sample_00161_B23WHTKLT4_1	9999000000	112938154	579572052	0.00%	0.79%	119436960	0.90%	0.94%	0.08%	0.06%	107683540	54346697	9028250	3598626	186.34	79.00	0.65%	0.45%	0.97	0.000	136.7bp	126.0bp	0.01%	0.88%	0.45%	0.00%	0.01%	2.83%	0.72%	0.00%	No	0.00%				153bp	308bp	79.8%	0.0%	97.3%	89.4%	96.0%	278.1M	54.8%	97.2%	70905.3Mb	579.6M	56.0%	98.6%	63.6%
tih_rna_sample_00161_B23WHTKLT4_1_1																																	136.7bp	98.3%	284.8M																88.8%	55%	151bp	151bp	18%	293.8M
tih_rna_sample_00161_B23WHTKLT4_1_2																																																			87.7%	55%	151bp	151bp	18%	293.8M
tih_rna_sample_00161_B23WHTKLT4_1_trimmed_1																																																			88.9%	55%	126bp	132bp	9%	289.8M	88.9%	55%	126bp	132bp	9%	289.8M
tih_rna_sample_00161_B23WHTKLT4_1_trimmed_2																																																			88.8%	56%	126bp	132bp	9%	289.8M	88.8%	56%	126bp	132bp	9%	289.8M
tih_rna_sample_00161_B23WHTKLT4_2	9990000000	135153117	591635594	0.00%	0.71%	171096385	0.92%	0.95%	0.06%	0.05%	157280037	79473971	10995201	4162964	285.89	126.00	0.70%	0.54%	0.98	0.000	141.0bp	131.0bp	0.01%	0.88%	0.44%	0.00%	0.01%	2.83%	0.71%	0.00%	No	0.00%				163bp	343bp	71.4%	0.0%	97.2%	89.4%	96.0%	284.0M	49.4%	97.4%	73857.0Mb	591.6M	55.9%	98.6%	60.1%
tih_rna_sample_00161_B23WHTKLT4_2_1																																	141.0bp	98.2%	290.5M																88.6%	55%	151bp	151bp	18%	377.6M
tih_rna_sample_00161_B23WHTKLT4_2_2																																																			87.3%	55%	151bp	151bp	18%	377.6M
tih_rna_sample_00161_B23WHTKLT4_2_trimmed_1																																																			86.8%	55%	128bp	137bp	9%	295.8M	86.8%	55%	128bp	137bp	9%	295.8M
tih_rna_sample_00161_B23WHTKLT4_2_trimmed_2																																																			86.8%	56%	128bp	137bp	9%	295.8M	86.8%	56%	128bp	137bp	9%	295.8M
tih_rna_sample_00163_B23WHTKLT4_1	9999000000	127339028	372716578	0.00%	0.60%	148441779	0.93%	0.96%	0.06%	0.04%	138395026	70112147	8365815	2885002	270.39	123.00	0.69%	0.54%	0.98	0.000	155.5bp	142.0bp	0.01%	1.30%	0.41%	0.00%	0.02%	4.09%	0.66%	0.00%	No	0.00%				192bp	439bp	60.4%	0.0%	96.9%	90.5%	96.2%	179.3M	42.7%	97.5%	48003.9Mb	372.7M	54.8%	98.6%	51.4%
tih_rna_sample_00163_B23WHTKLT4_1_1																																	155.5bp	98.1%	182.9M																82.9%	54%	151bp	151bp	18%	188.9M
tih_rna_sample_00163_B23WHTKLT4_1_2																																																			82.2%	54%	151bp	151bp	18%	188.9M
tih_rna_sample_00163_B23WHTKLT4_1_trimmed_1																																																			82.9%	54%	132bp	147bp	9%	186.4M	82.9%	54%	132bp	147bp	9%	186.4M
tih_rna_sample_00163_B23WHTKLT4_1_trimmed_2																																																			83.2%	55%	132bp	147bp	9%	186.4M	83.2%	55%	132bp	147bp	9%	186.4M
tih_rna_sample_00163_B23WHTKLT4_2	9990000000	191609972	590349796	0.00%	0.62%	222090069	0.93%	0.96%	0.06%	0.04%	206321140	104460096	12965061	4517031	395.43	187.00	0.73%	0.60%	0.98	0.000	150.1bp	136.0bp	0.01%	1.36%	0.42%	0.00%	0.02%	4.25%	0.68%	0.00%	No	0.00%				180bp	405bp	62.7%	0.0%	96.9%	90.2%	96.1%	283.6M	42.6%	97.5%	74357.1Mb	590.3M	54.7%	98.4%	54.5%
tih_rna_sample_00163_B23WHTKLT4_2_1																																	150.1bp	98.1%	289.7M																86.1%	54%	151bp	151bp	18%	324.4M
tih_rna_sample_00163_B23WHTKLT4_2_2																																																			85.4%	54%	151bp	151bp	18%	324.4M
tih_rna_sample_00163_B23WHTKLT4_2_trimmed_1																																																			85.5%	54%	129bp	142bp	9%	295.2M	85.5%	54%	129bp	142bp	9%	295.2M
tih_rna_sample_00163_B23WHTKLT4_2_trimmed_2																																																			86.0%	54%	129bp	142bp	9%	295.2M	86.0%	54%	129bp	142bp	9%	295.2M
tih_rna_sample_00164_B23WHTKLT4_1	9999000000	53748044	494548986	0.01%	0.88%	57272375	0.84%	0.91%	0.10%	0.09%	48030543	24210162	5798197	2409554	80.11	28.00	0.49%	0.21%	0.97	0.000	135.3bp	126.0bp	0.01%	0.83%	0.43%	0.00%	0.02%	2.49%	0.65%	0.00%	No	0.00%				146bp	278bp	89.0%	0.0%	97.7%	87.8%	95.4%	235.9M	62.9%	97.4%	60352.9Mb	494.5M	56.8%	98.4%	65.0%
tih_rna_sample_00164_B23WHTKLT4_1_1																																	135.3bp	98.2%	242.8M																91.6%	55%	151bp	151bp	18%	251.4M
tih_rna_sample_00164_B23WHTKLT4_1_2																																																			89.8%	56%	151bp	151bp	18%	251.4M
tih_rna_sample_00164_B23WHTKLT4_1_trimmed_1																																																			91.7%	56%	125bp	132bp	9%	247.3M	91.7%	56%	125bp	132bp	9%	247.3M
tih_rna_sample_00164_B23WHTKLT4_1_trimmed_2																																																			91.1%	57%	125bp	132bp	9%	247.3M	91.1%	57%	125bp	132bp	9%	247.3M
tih_rna_sample_00164_B23WHTKLT4_2	9999000000	52473351	268537882	0.01%	0.79%	55370963	0.88%	0.93%	0.08%	0.07%	48708093	24574793	4542539	1824034	81.93	28.00	0.49%	0.22%	0.97	0.000	133.2bp	124.0bp	0.01%	0.80%	0.40%	0.00%	0.02%	2.38%	0.61%	0.00%	No	0.00%				142bp	261bp	80.0%	0.0%	97.4%	85.5%	94.9%	127.4M	52.7%	97.3%	32426.2Mb	268.5M	57.1%	98.4%	66.4%
tih_rna_sample_00164_B23WHTKLT4_2_1																																	133.2bp	97.9%	131.4M																86.7%	55%	151bp	151bp	18%	136.5M
tih_rna_sample_00164_B23WHTKLT4_2_2																																																			85.3%	56%	151bp	151bp	18%	136.5M
tih_rna_sample_00164_B23WHTKLT4_2_trimmed_1																																																			86.8%	56%	124bp	127bp	9%	134.3M	86.8%	56%	124bp	127bp	9%	134.3M
tih_rna_sample_00164_B23WHTKLT4_2_trimmed_2																																																			86.3%	57%	124bp	127bp	9%	134.3M	86.3%	57%	124bp	127bp	9%	134.3M
tih_rna_sample_00166_B23WHTKLT4_1	9999000000	113652557	590697846	0.00%	0.77%	134707465	0.91%	0.95%	0.07%	0.05%	123110137	62216241	8876247	3262548	228.37	104.00	0.67%	0.51%	0.98	0.000	146.9bp	134.0bp	0.01%	0.97%	0.41%	0.00%	0.01%	3.13%	0.67%	0.00%	No	0.00%				177bp	414bp	77.6%	0.0%	97.6%	90.6%	96.1%	283.7M	55.9%	97.5%	74828.9Mb	590.7M	54.0%	98.4%	55.1%
tih_rna_sample_00166_B23WHTKLT4_1_1																																	146.9bp	98.4%	290.7M																89.2%	53%	151bp	151bp	18%	312.5M
tih_rna_sample_00166_B23WHTKLT4_1_2																																																			87.9%	53%	151bp	151bp	18%	312.5M
tih_rna_sample_00166_B23WHTKLT4_1_trimmed_1																																																			89.0%	53%	130bp	142bp	9%	295.3M	89.0%	53%	130bp	142bp	9%	295.3M
tih_rna_sample_00166_B23WHTKLT4_1_trimmed_2																																																			89.1%	54%	130bp	142bp	9%	295.3M	89.1%	54%	130bp	142bp	9%	295.3M
tih_rna_sample_00166_B23WHTKLT4_2	9999000000	163730854	458492152	0.00%	0.59%	189488002	0.94%	0.97%	0.05%	0.03%	178109889	90036950	9280270	3198719	339.90	163.00	0.72%	0.58%	0.98	0.000	145.2bp	132.0bp	0.01%	0.97%	0.41%	0.00%	0.02%	3.12%	0.67%	0.00%	No	0.00%				170bp	384bp	58.9%	0.0%	97.6%	90.5%	96.1%	220.2M	40.1%	97.5%	57688.6Mb	458.5M	54.6%	98.8%	56.6%
tih_rna_sample_00166_B23WHTKLT4_2_1																																	145.2bp	98.4%	225.7M																84.2%	54%	151bp	151bp	18%	232.1M
tih_rna_sample_00166_B23WHTKLT4_2_2																																																			83.5%	54%	151bp	151bp	18%	232.1M
tih_rna_sample_00166_B23WHTKLT4_2_trimmed_1																																																			84.2%	54%	129bp	142bp	9%	229.2M	84.2%	54%	129bp	142bp	9%	229.2M
tih_rna_sample_00166_B23WHTKLT4_2_trimmed_2																																																			84.5%	54%	129bp	142bp	9%	229.2M	84.5%	54%	129bp	142bp	9%	229.2M
tih_rna_sample_00434_B23WHTKLT4_1	9999000000	106089627	591311356	0.00%	0.77%	137710128	0.91%	0.94%	0.07%	0.06%	125580578	63342834	9522243	3735169	223.03	109.00	0.68%	0.52%	0.97	0.000	134.2bp	124.0bp	0.01%	1.16%	0.50%	0.00%	0.01%	3.45%	0.75%	0.00%	No	0.00%				143bp	283bp	77.1%	0.0%	97.5%	89.6%	95.7%	283.1M	50.2%	97.3%	71406.1Mb	591.3M	55.6%	98.6%	64.0%
tih_rna_sample_00434_B23WHTKLT4_1_1																																	134.2bp	98.4%	291.0M																90.6%	54%	151bp	151bp	18%	420.8M
tih_rna_sample_00434_B23WHTKLT4_1_2																																																			89.2%	55%	151bp	151bp	18%	420.8M
tih_rna_sample_00434_B23WHTKLT4_1_trimmed_1																																																			88.4%	55%	124bp	132bp	9%	295.7M	88.4%	55%	124bp	132bp	9%	295.7M
tih_rna_sample_00434_B23WHTKLT4_1_trimmed_2																																																			88.2%	55%	124bp	132bp	9%	295.7M	88.2%	55%	124bp	132bp	9%	295.7M
tih_rna_sample_00434_B23WHTKLT4_2	9999000000	169019011	591815104	0.00%	0.64%	213476537	0.93%	0.96%	0.06%	0.04%	199125917	100636196	11748870	4265354	371.31	192.00	0.74%	0.61%	0.98	0.000	142.8bp	131.0bp	0.01%	1.14%	0.48%	0.00%	0.02%	3.44%	0.72%	0.00%	No	0.00%				159bp	349bp	64.2%	0.0%	97.3%	90.0%	95.8%	283.5M	43.6%	97.4%	73742.7Mb	591.8M	54.6%	98.6%	58.6%
tih_rna_sample_00434_B23WHTKLT4_2_1																																	142.8bp	98.4%	291.1M																88.2%	53%	151bp	151bp	18%	412.3M
tih_rna_sample_00434_B23WHTKLT4_2_2																																																			87.1%	54%	151bp	151bp	18%	412.3M
tih_rna_sample_00434_B23WHTKLT4_2_trimmed_1																																																			85.9%	54%	128bp	137bp	9%	295.9M	85.9%	54%	128bp	137bp	9%	295.9M
tih_rna_sample_00434_B23WHTKLT4_2_trimmed_2																																																			85.9%	54%	128bp	137bp	9%	295.9M	85.9%	54%	128bp	137bp	9%	295.9M
tih_rna_sample_00451_B23WHTKLT4_1	9990000000	156331168	573379982	0.01%	0.67%	189721141	0.92%	0.95%	0.07%	0.05%	174226945	87946530	12382225	4862106	308.11	179.00	0.76%	0.62%	0.98	0.000	138.7bp	128.0bp	0.01%	0.69%	0.41%	0.00%	0.01%	2.16%	0.61%	0.00%	No	0.00%				147bp	291bp	67.3%	0.0%	96.9%	89.3%	95.7%	274.2M	45.6%	97.5%	70730.1Mb	573.4M	53.9%	98.7%	62.5%
tih_rna_sample_00451_B23WHTKLT4_1_1																																	138.7bp	98.0%	280.9M																85.3%	53%	151bp	151bp	18%	290.5M
tih_rna_sample_00451_B23WHTKLT4_1_2																																																			84.4%	54%	151bp	151bp	18%	290.5M
tih_rna_sample_00451_B23WHTKLT4_1_trimmed_1																																																			85.4%	53%	127bp	132bp	9%	286.7M	85.4%	53%	127bp	132bp	9%	286.7M
tih_rna_sample_00451_B23WHTKLT4_1_trimmed_2																																																			85.5%	54%	127bp	132bp	9%	286.7M	85.5%	54%	127bp	132bp	9%	286.7M
tih_rna_sample_00451_B23WHTKLT4_2	9999000000	229535546	345125830	0.01%	0.43%	195072298	0.94%	0.96%	0.05%	0.04%	183279181	92453109	9838543	3708700	330.06	193.00	0.77%	0.63%	0.98	0.000	137.8bp	127.0bp	0.01%	0.70%	0.42%	0.00%	0.01%	2.19%	0.61%	0.00%	No	0.00%				143bp	277bp	43.7%	0.0%	96.9%	89.1%	95.5%	164.9M	27.5%	97.5%	42185.6Mb	345.1M	54.1%	98.7%	63.7%
tih_rna_sample_00451_B23WHTKLT4_2_1																																	137.8bp	98.0%	169.1M																77.8%	53%	151bp	151bp	18%	174.9M
tih_rna_sample_00451_B23WHTKLT4_2_2																																																			77.1%	53%	151bp	151bp	18%	174.9M
tih_rna_sample_00451_B23WHTKLT4_2_trimmed_1																																																			77.8%	53%	125bp	132bp	9%	172.6M	77.8%	53%	125bp	132bp	9%	172.6M
tih_rna_sample_00451_B23WHTKLT4_2_trimmed_2																																																			78.1%	54%	125bp	132bp	9%	172.6M	78.1%	54%	125bp	132bp	9%	172.6M
tih_rna_sample_00457_B23WHTKLT4_1	9990000000	133548745	591287550	0.00%	0.71%	169976412	0.93%	0.96%	0.06%	0.04%	157356141	79646794	9716121	3332792	303.88	132.00	0.71%	0.55%	0.97	0.000	152.1bp	139.0bp	0.01%	0.68%	0.36%	0.00%	0.01%	2.23%	0.57%	0.00%	No	0.00%				192bp	468bp	71.6%	0.0%	97.7%	91.2%	96.4%	284.9M	50.4%	97.3%	75333.6Mb	591.3M	55.7%	98.5%	53.1%
tih_rna_sample_00457_B23WHTKLT4_1_1																																	152.1bp	98.4%	291.0M																90.0%	55%	151bp	151bp	18%	405.7M
tih_rna_sample_00457_B23WHTKLT4_1_2																																																			89.0%	55%	151bp	151bp	18%	405.7M
tih_rna_sample_00457_B23WHTKLT4_1_trimmed_1																																																			88.1%	55%	131bp	147bp	9%	295.6M	88.1%	55%	131bp	147bp	9%	295.6M
tih_rna_sample_00457_B23WHTKLT4_1_trimmed_2																																																			88.3%	55%	131bp	147bp	9%	295.6M	88.3%	55%	131bp	147bp	9%	295.6M
tih_rna_sample_00457_B23WHTKLT4_2	9990000000	169610865	591890736	0.01%	0.65%	206836235	0.93%	0.96%	0.05%	0.04%	193182086	97770202	10681356	3574164	375.49	164.00	0.73%	0.59%	0.97	0.000	150.0bp	137.0bp	0.01%	0.68%	0.37%	0.00%	0.01%	2.21%	0.58%	0.00%	No	0.00%				187bp	445bp	65.4%	0.0%	97.7%	91.0%	96.3%	285.0M	46.1%	97.4%	75245.0Mb	591.9M	56.2%	98.6%	54.1%
tih_rna_sample_00457_B23WHTKLT4_2_1																																	150.0bp	98.4%	291.3M																87.2%	55%	151bp	151bp	18%	306.4M
tih_rna_sample_00457_B23WHTKLT4_2_2																																																			86.3%	56%	151bp	151bp	18%	306.4M
tih_rna_sample_00457_B23WHTKLT4_2_trimmed_1																																																			87.1%	55%	130bp	142bp	9%	295.9M	87.1%	55%	130bp	142bp	9%	295.9M
tih_rna_sample_00457_B23WHTKLT4_2_trimmed_2																																																			87.2%	56%	131bp	142bp	9%	295.9M	87.2%	56%	131bp	142bp	9%	295.9M
tih_rna_sample_00461_B23WHTKLT4_1	9999000000	9450203	101224170	0.00%	0.92%	8254201	0.82%	0.89%	0.13%	0.11%	6764310	3421303	1057314	426391	12.41	4.00	0.10%	0.01%	0.97	0.000	154.0bp	140.0bp	0.01%	0.96%	0.48%	0.00%	0.02%	2.84%	0.69%	0.00%	No	0.00%				185bp	449bp	92.2%	0.0%	97.2%	89.5%	96.0%	48.6M	69.2%	97.4%	13019.3Mb	101.2M	54.6%	97.3%	52.3%
tih_rna_sample_00461_B23WHTKLT4_1_1																																	154.0bp	98.2%	49.7M																92.0%	54%	151bp	151bp	18%	52.0M
tih_rna_sample_00461_B23WHTKLT4_1_2																																																			90.1%	55%	151bp	151bp	27%	52.0M
tih_rna_sample_00461_B23WHTKLT4_1_trimmed_1																																																			92.0%	54%	132bp	147bp	9%	50.6M	92.0%	54%	132bp	147bp	9%	50.6M
tih_rna_sample_00461_B23WHTKLT4_1_trimmed_2																																																			91.4%	54%	132bp	147bp	9%	50.6M	91.4%	54%	132bp	147bp	9%	50.6M
tih_rna_sample_00461_B23WHTKLT4_2	9999000000	218933094	384330140	0.00%	0.47%	202736080	0.94%	0.97%	0.05%	0.03%	190735049	96452032	10282139	3473760	365.76	149.00	0.68%	0.55%	0.97	0.000	146.6bp	133.0bp	0.02%	1.06%	0.49%	0.00%	0.04%	3.12%	0.71%	0.00%	No	0.00%				169bp	395bp	47.5%	0.0%	97.1%	89.0%	95.8%	184.0M	31.4%	97.4%	48164.2Mb	384.3M	54.2%	98.3%	56.1%
tih_rna_sample_00461_B23WHTKLT4_2_1																																	146.6bp	98.2%	188.6M																82.0%	53%	151bp	151bp	18%	195.6M
tih_rna_sample_00461_B23WHTKLT4_2_2																																																			81.3%	54%	151bp	151bp	18%	195.6M
tih_rna_sample_00461_B23WHTKLT4_2_trimmed_1																																																			82.0%	53%	129bp	142bp	9%	192.2M	82.0%	53%	129bp	142bp	9%	192.2M
tih_rna_sample_00461_B23WHTKLT4_2_trimmed_2																																																			82.6%	54%	129bp	142bp	9%	192.2M	82.6%	54%	129bp	142bp	9%	192.2M
tih_rna_sample_00462_B23WHTKLT4_1	9999000000	145467716	591421534	0.00%	0.68%	187274401	0.93%	0.97%	0.05%	0.03%	174949893	88589159	9732318	3183905	342.42	134.00	0.67%	0.55%	0.98	0.000	154.2bp	139.0bp	0.00%	0.76%	0.65%	0.00%	0.01%	2.42%	0.89%	0.00%	No	0.00%				206bp	544bp	68.6%	0.0%	97.7%	92.4%	96.7%	286.1M	48.8%	97.5%	75850.8Mb	591.4M	54.7%	98.6%	51.6%
tih_rna_sample_00462_B23WHTKLT4_1_1																																	154.2bp	98.4%	290.9M																90.2%	54%	151bp	151bp	18%	431.1M
tih_rna_sample_00462_B23WHTKLT4_1_2																																																			89.1%	54%	151bp	151bp	18%	431.1M
tih_rna_sample_00462_B23WHTKLT4_1_trimmed_1																																																			87.9%	54%	132bp	147bp	9%	295.7M	87.9%	54%	132bp	147bp	9%	295.7M
tih_rna_sample_00462_B23WHTKLT4_1_trimmed_2																																																			88.0%	54%	132bp	147bp	9%	295.7M	88.0%	54%	132bp	147bp	9%	295.7M
tih_rna_sample_00462_B23WHTKLT4_2	9999000000	249927144	592168176	0.00%	0.55%	264553359	0.95%	0.97%	0.04%	0.03%	250026212	126639063	11902731	3663244	509.65	211.00	0.70%	0.60%	0.97	0.000	158.2bp	144.0bp	0.00%	0.75%	0.65%	0.00%	0.01%	2.38%	0.90%	0.00%	No	0.00%				220bp	594bp	55.6%	0.0%	97.6%	92.4%	96.8%	286.5M	39.8%	97.4%	77140.4Mb	592.2M	54.8%	98.7%	49.0%
tih_rna_sample_00462_B23WHTKLT4_2_1																																	158.2bp	98.3%	291.1M																86.3%	54%	151bp	151bp	18%	320.2M
tih_rna_sample_00462_B23WHTKLT4_2_2																																																			85.4%	54%	151bp	151bp	18%	320.2M
tih_rna_sample_00462_B23WHTKLT4_2_trimmed_1																																																			85.9%	54%	134bp	151bp	9%	296.1M	85.9%	54%	134bp	151bp	9%	296.1M
tih_rna_sample_00462_B23WHTKLT4_2_trimmed_2																																																			86.1%	55%	134bp	151bp	9%	296.1M	86.1%	55%	134bp	151bp	9%	296.1M
tih_rna_sample_00464_B23WHTKLT4_1	9999000000	119695884	548980454	0.01%	0.77%	128760413	0.90%	0.94%	0.07%	0.06%	116356559	58749292	9453563	3747221	204.61	94.00	0.67%	0.49%	0.97	0.000	138.6bp	128.0bp	0.01%	1.29%	0.55%	0.00%	0.01%	3.90%	0.82%	0.00%	No	0.00%				153bp	330bp	77.0%	0.0%	97.2%	90.1%	95.9%	263.2M	52.3%	97.2%	67541.0Mb	549.0M	54.0%	98.6%	62.1%
tih_rna_sample_00464_B23WHTKLT4_1_1																																	138.6bp	98.2%	269.5M																88.0%	53%	151bp	151bp	18%	278.4M
tih_rna_sample_00464_B23WHTKLT4_1_2																																																			86.9%	53%	151bp	151bp	18%	278.4M
tih_rna_sample_00464_B23WHTKLT4_1_trimmed_1																																																			88.1%	53%	126bp	132bp	9%	274.5M	88.1%	53%	126bp	132bp	9%	274.5M
tih_rna_sample_00464_B23WHTKLT4_1_trimmed_2																																																			88.0%	54%	127bp	132bp	9%	274.5M	88.0%	54%	127bp	132bp	9%	274.5M
tih_rna_sample_00464_B23WHTKLT4_2	9999000000	117613500	402957022	0.01%	0.64%	146204520	0.92%	0.95%	0.06%	0.05%	135236780	68178642	8788333	3404484	234.35	111.00	0.68%	0.52%	0.98	0.000	132.1bp	121.0bp	0.01%	1.35%	0.57%	0.00%	0.02%	4.03%	0.86%	0.00%	No	0.00%				139bp	281bp	64.1%	0.0%	97.2%	89.4%	95.7%	192.8M	40.1%	97.5%	47966.5Mb	403.0M	54.1%	98.3%	66.3%
tih_rna_sample_00464_B23WHTKLT4_2_1																																	132.1bp	98.2%	197.8M																83.4%	53%	151bp	151bp	18%	204.9M
tih_rna_sample_00464_B23WHTKLT4_2_2																																																			82.7%	54%	151bp	151bp	18%	204.9M
tih_rna_sample_00464_B23WHTKLT4_2_trimmed_1																																																			83.4%	53%	122bp	127bp	9%	201.5M	83.4%	53%	122bp	127bp	9%	201.5M
tih_rna_sample_00464_B23WHTKLT4_2_trimmed_2																																																			83.9%	54%	122bp	127bp	9%	201.5M	83.9%	54%	122bp	127bp	9%	201.5M
tih_rna_sample_00467_B23WHTKLT4_1	9999000000	98862201	578835000	0.01%	0.82%	101713660	0.86%	0.91%	0.10%	0.09%	87674160	44121632	10072620	4353314	140.84	53.00	0.60%	0.36%	0.97	0.000	130.1bp	123.0bp	0.01%	1.34%	0.49%	0.00%	0.01%	4.03%	0.79%	0.00%	No	0.00%				134bp	214bp	83.0%	0.0%	96.9%	85.1%	94.5%	273.6M	55.7%	97.1%	69037.5Mb	578.8M	58.4%	98.4%	69.8%
tih_rna_sample_00467_B23WHTKLT4_1_1																																	130.1bp	97.7%	282.7M																89.5%	57%	151bp	151bp	18%	294.0M
tih_rna_sample_00467_B23WHTKLT4_1_2																																																			88.2%	57%	151bp	151bp	18%	294.0M
tih_rna_sample_00467_B23WHTKLT4_1_trimmed_1																																																			89.6%	58%	123bp	127bp	9%	289.4M	89.6%	58%	123bp	127bp	9%	289.4M
tih_rna_sample_00467_B23WHTKLT4_1_trimmed_2																																																			89.4%	58%	123bp	127bp	9%	289.4M	89.4%	58%	123bp	127bp	9%	289.4M
tih_rna_sample_00467_B23WHTKLT4_2	9999000000	142291644	590301006	0.01%	0.71%	170721726	0.91%	0.94%	0.07%	0.06%	154658499	77791860	12049033	5049472	245.03	99.00	0.68%	0.50%	0.97	0.000	121.9bp	115.0bp	0.01%	1.40%	0.50%	0.00%	0.01%	4.15%	0.81%	0.00%	No	0.00%				123bp	186bp	71.6%	0.0%	97.0%	84.3%	94.3%	278.2M	42.4%	97.3%	67474.3Mb	590.3M	58.4%	98.4%	74.7%
tih_rna_sample_00467_B23WHTKLT4_2_1																																	121.9bp	97.8%	288.6M																86.9%	56%	151bp	151bp	18%	311.5M
tih_rna_sample_00467_B23WHTKLT4_2_2																																																			85.7%	57%	151bp	151bp	18%	311.5M
tih_rna_sample_00467_B23WHTKLT4_2_trimmed_1																																																			86.6%	58%	117bp	117bp	9%	295.2M	86.6%	58%	117bp	117bp	9%	295.2M
tih_rna_sample_00467_B23WHTKLT4_2_trimmed_2																																																			86.7%	58%	118bp	117bp	9%	295.2M	86.7%	58%	118bp	117bp	9%	295.2M
tih_rna_sample_00473_B23WHTKLT4_1	9999000000	147541006	590684508	0.00%	0.70%	174933661	0.93%	0.96%	0.05%	0.04%	163230041	82560058	9071127	3010133	318.65	123.00	0.67%	0.53%	0.97	0.000	153.3bp	138.0bp	0.01%	0.72%	0.53%	0.00%	0.01%	2.24%	0.77%	0.00%	No	0.00%				197bp	496bp	70.7%	0.0%	98.0%	90.7%	96.2%	284.3M	49.2%	97.4%	75499.0Mb	590.7M	55.0%	98.4%	52.4%
tih_rna_sample_00473_B23WHTKLT4_1_1																																	153.3bp	98.3%	290.3M																90.9%	54%	151bp	151bp	27%	482.0M
tih_rna_sample_00473_B23WHTKLT4_1_2																																																			89.6%	55%	151bp	151bp	18%	482.0M
tih_rna_sample_00473_B23WHTKLT4_1_trimmed_1																																																			87.9%	54%	131bp	147bp	9%	295.3M	87.9%	54%	131bp	147bp	9%	295.3M
tih_rna_sample_00473_B23WHTKLT4_1_trimmed_2																																																			88.0%	55%	131bp	147bp	9%	295.3M	88.0%	55%	131bp	147bp	9%	295.3M
tih_rna_sample_00473_B23WHTKLT4_2	9999000000	196616163	591410084	0.00%	0.61%	229425854	0.94%	0.97%	0.05%	0.03%	216384884	109496036	10439298	3255352	439.47	177.00	0.70%	0.58%	0.97	0.000	156.4bp	143.0bp	0.01%	0.71%	0.53%	0.00%	0.01%	2.20%	0.76%	0.00%	No	0.00%				210bp	541bp	61.5%	0.0%	98.0%	91.0%	96.3%	284.9M	44.1%	97.4%	76958.7Mb	591.4M	55.0%	98.6%	49.4%
tih_rna_sample_00473_B23WHTKLT4_2_1																																	156.4bp	98.3%	290.7M																90.1%	54%	151bp	151bp	18%	526.3M
tih_rna_sample_00473_B23WHTKLT4_2_2																																																			88.7%	55%	151bp	151bp	18%	526.3M
tih_rna_sample_00473_B23WHTKLT4_2_trimmed_1																																																			86.3%	54%	134bp	151bp	9%	295.7M	86.3%	54%	134bp	151bp	9%	295.7M
tih_rna_sample_00473_B23WHTKLT4_2_trimmed_2																																																			86.3%	55%	134bp	151bp	9%	295.7M	86.3%	55%	134bp	151bp	9%	295.7M
tih_rna_sample_00479_B23WHTKLT4_1	9999000000	160839185	591724432	0.00%	0.68%	190751605	0.93%	0.96%	0.06%	0.04%	177651786	89861512	10648521	3728848	341.48	144.00	0.71%	0.57%	0.97	0.000	150.8bp	139.0bp	0.01%	1.26%	0.50%	0.00%	0.01%	4.00%	0.79%	0.00%	No	0.00%				208bp	546bp	68.0%	0.0%	97.6%	90.6%	96.1%	284.5M	49.6%	97.4%	75868.3Mb	591.7M	54.3%	98.6%	53.8%
tih_rna_sample_00479_B23WHTKLT4_1_1																																	150.8bp	98.5%	291.3M																89.1%	53%	151bp	151bp	18%	374.1M
tih_rna_sample_00479_B23WHTKLT4_1_2																																																			88.0%	54%	151bp	151bp	18%	374.1M
tih_rna_sample_00479_B23WHTKLT4_1_trimmed_1																																																			87.6%	54%	132bp	147bp	9%	295.9M	87.6%	54%	132bp	147bp	9%	295.9M
tih_rna_sample_00479_B23WHTKLT4_1_trimmed_2																																																			87.7%	54%	132bp	147bp	9%	295.9M	87.7%	54%	132bp	147bp	9%	295.9M
tih_rna_sample_00479_B23WHTKLT4_2	9999000000	232321953	375961592	0.00%	0.47%	198468648	0.95%	0.97%	0.05%	0.03%	187722582	94881908	9132494	3058813	363.91	157.00	0.72%	0.58%	0.97	0.000	145.9bp	133.0bp	0.01%	1.30%	0.51%	0.00%	0.01%	4.09%	0.80%	0.00%	No	0.00%				194bp	495bp	47.4%	0.0%	97.6%	90.1%	96.0%	180.5M	31.1%	97.4%	47328.8Mb	376.0M	54.4%	98.5%	56.2%
tih_rna_sample_00479_B23WHTKLT4_2_1																																	145.9bp	98.4%	185.0M																81.8%	53%	151bp	151bp	18%	190.8M
tih_rna_sample_00479_B23WHTKLT4_2_2																																																			81.1%	54%	151bp	151bp	18%	190.8M
tih_rna_sample_00479_B23WHTKLT4_2_trimmed_1																																																			81.8%	54%	129bp	142bp	9%	188.0M	81.8%	54%	129bp	142bp	9%	188.0M
tih_rna_sample_00479_B23WHTKLT4_2_trimmed_2																																																			82.3%	54%	129bp	142bp	9%	188.0M	82.3%	54%	129bp	142bp	9%	188.0M
tih_rna_sample_00480_B23WHTKLT4_1	9999000000	147124207	565984516	0.01%	0.72%	158086563	0.91%	0.95%	0.07%	0.05%	144418081	72981531	10754705	4072625	267.88	128.00	0.72%	0.55%	0.97	0.000	147.0bp	135.0bp	0.01%	1.13%	0.47%	0.00%	0.02%	3.56%	0.70%	0.00%	No	0.00%				164bp	346bp	72.4%	0.0%	97.2%	89.1%	95.9%	271.5M	50.8%	97.2%	71341.8Mb	566.0M	55.0%	98.5%	56.4%
tih_rna_sample_00480_B23WHTKLT4_1_1																																	147.0bp	98.0%	277.4M																87.3%	54%	151bp	151bp	18%	287.4M
tih_rna_sample_00480_B23WHTKLT4_1_2																																																			86.1%	54%	151bp	151bp	18%	287.4M
tih_rna_sample_00480_B23WHTKLT4_1_trimmed_1																																																			87.4%	54%	130bp	142bp	9%	283.0M	87.4%	54%	130bp	142bp	9%	283.0M
tih_rna_sample_00480_B23WHTKLT4_1_trimmed_2																																																			87.4%	55%	130bp	142bp	9%	283.0M	87.4%	55%	130bp	142bp	9%	283.0M
tih_rna_sample_00480_B23WHTKLT4_2	9990000000	221237809	590775868	0.01%	0.58%	245181184	0.93%	0.96%	0.06%	0.04%	228481373	115410082	13588581	4970868	430.78	219.00	0.76%	0.64%	0.97	0.000	145.6bp	134.0bp	0.01%	1.16%	0.48%	0.00%	0.02%	3.62%	0.71%	0.00%	No	0.00%				161bp	340bp	58.8%	0.0%	97.2%	89.2%	95.9%	283.4M	40.2%	97.3%	74171.3Mb	590.8M	54.7%	98.5%	57.4%
tih_rna_sample_00480_B23WHTKLT4_2_1																																	145.6bp	98.0%	289.6M																86.1%	53%	151bp	151bp	18%	365.3M
tih_rna_sample_00480_B23WHTKLT4_2_2																																																			85.1%	54%	151bp	151bp	18%	365.3M
tih_rna_sample_00480_B23WHTKLT4_2_trimmed_1																																																			84.6%	54%	129bp	142bp	9%	295.4M	84.6%	54%	129bp	142bp	9%	295.4M
tih_rna_sample_00480_B23WHTKLT4_2_trimmed_2																																																			84.8%	54%	129bp	142bp	9%	295.4M	84.8%	54%	129bp	142bp	9%	295.4M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
659_6i-T1-TRNA-1_B23WHTKLT4_1	417.9M	0.0M	0.0M	30.9M	2.3M	372.3M	186.3M	186.0M	186.2M	186.1M	212.9M	159.5M	370.8M	0.0M
659_Dl-T1-TRNA-1_B23WHTKLT4_1	335.9M	0.0M	0.0M	33.9M	2.2M	286.6M	143.4M	143.2M	143.3M	143.3M	163.5M	123.2M	285.7M	0.0M
659_Lx-T1-TRNA-1_B23WHTKLT4_1	530.8M	0.0M	0.0M	32.0M	2.1M	483.2M	241.7M	241.5M	241.6M	241.6M	260.6M	222.6M	481.2M	0.0M
659_Mt-T1-TRNA-1_B23WHTKLT4_1	363.8M	0.0M	0.0M	32.9M	1.9M	315.7M	157.9M	157.8M	157.9M	157.8M	174.8M	140.9M	314.6M	0.0M
659_bCu-T1-TRNA-1_B23WHTKLT4_1	148.9M	0.0M	0.0M	13.4M	1.0M	129.5M	64.8M	64.7M	64.7M	64.7M	80.6M	48.9M	129.0M	0.0M
659_bGW-T1-TRNA-1_B23WHTKLT4_1	640.1M	0.0M	0.0M	46.4M	2.9M	571.3M	285.8M	285.6M	285.7M	285.6M	283.9M	287.4M	569.3M	0.0M
659_bGc-T1-TRNA-1_B23WHTKLT4_1	408.9M	0.0M	0.0M	25.3M	2.1M	370.8M	185.5M	185.3M	185.4M	185.4M	200.8M	169.9M	369.5M	0.0M
659_bNS-T1-TRNA-1_B23WHTKLT4_1	631.6M	0.0M	0.0M	38.0M	3.0M	573.8M	287.0M	286.8M	287.0M	286.9M	278.1M	295.7M	571.8M	0.0M
659_bQZ-T1-TRNA-1_B23WHTKLT4_1	594.1M	0.0M	0.0M	44.1M	3.7M	527.4M	263.8M	263.6M	263.7M	263.6M	272.8M	254.6M	525.6M	0.0M
659_bTo-T1-TRNA-1_B23WHTKLT4_1	623.3M	0.0M	0.0M	28.9M	2.4M	578.8M	289.5M	289.3M	289.4M	289.3M	263.6M	315.1M	576.8M	0.0M
659_bUW-T1-TRNA-1_B23WHTKLT4_1	651.8M	0.0M	0.0M	57.7M	2.7M	562.6M	281.4M	281.2M	281.3M	281.3M	262.3M	300.4M	560.9M	0.0M
659_bhK-T1-TRNA-1_B23WHTKLT4_1	622.5M	0.0M	0.0M	28.8M	3.0M	577.4M	288.8M	288.6M	288.8M	288.6M	270.2M	307.2M	575.7M	0.0M
659_buD-T1-TRNA-1_B23WHTKLT4_1	467.6M	0.0M	0.0M	29.4M	2.5M	423.0M	211.6M	211.4M	211.5M	211.4M	214.5M	208.5M	421.4M	0.0M
659_bua-T1-TRNA-1_B23WHTKLT4_1	561.8M	0.0M	0.0M	29.6M	2.5M	516.7M	258.5M	258.2M	258.4M	258.3M	257.8M	258.9M	514.9M	0.0M
659_c95-T1-TRNA-1_B23WHTKLT4_1	639.1M	0.0M	0.0M	45.3M	3.0M	572.4M	286.3M	286.1M	286.2M	286.1M	280.9M	291.5M	570.5M	0.0M
659_cAd-T1-TRNA-1_B23WHTKLT4_1	636.8M	0.0M	0.0M	44.2M	3.6M	570.5M	285.4M	285.1M	285.3M	285.2M	307.7M	262.8M	568.3M	0.0M
659_cIX-T1-TRNA-1_B23WHTKLT4_1	627.5M	0.0M	0.0M	33.6M	2.6M	577.2M	288.7M	288.4M	288.6M	288.6M	292.6M	284.6M	575.3M	0.0M
659_cRB-T1-TRNA-1_B23WHTKLT4_1	525.7M	0.0M	0.0M	35.6M	2.7M	473.3M	236.8M	236.5M	236.7M	236.6M	248.4M	224.9M	471.3M	0.0M
659_cRa-T1-TRNA-1_B23WHTKLT4_1	626.3M	0.0M	0.0M	32.7M	3.1M	576.3M	288.3M	288.0M	288.3M	288.1M	255.3M	321.0M	574.4M	0.0M
659_cTi-T1-TRNA-1_B23WHTKLT4_1	629.0M	0.0M	0.0M	36.5M	3.4M	572.4M	286.3M	286.1M	286.3M	286.2M	281.0M	291.4M	570.3M	0.0M
659_cVw-T1-TRNA-1_B23WHTKLT4_1	638.7M	0.0M	0.0M	45.6M	3.3M	569.2M	284.7M	284.5M	284.6M	284.6M	286.7M	282.6M	567.6M	0.0M
659_cWx-T1-TRNA-1_B23WHTKLT4_1	641.2M	0.0M	0.0M	53.1M	3.4M	563.3M	281.8M	281.5M	281.7M	281.6M	304.8M	258.4M	561.4M	0.0M
659_cfy-T1-TRNA-1_B23WHTKLT4_1	626.2M	0.0M	0.0M	32.5M	2.4M	576.8M	288.5M	288.3M	288.5M	288.4M	278.5M	298.3M	574.8M	0.0M
659_ciJ-T1-TRNA-1_B23WHTKLT4_1	609.6M	0.0M	0.0M	36.6M	3.3M	553.4M	276.8M	276.6M	276.7M	276.7M	285.8M	267.5M	551.5M	0.0M
659_ciZ-T1-TRNA-1_B23WHTKLT4_1	641.2M	0.0M	0.0M	47.3M	2.9M	570.4M	285.3M	285.1M	285.2M	285.2M	310.3M	260.2M	568.2M	0.0M
659_d01-T1-TRNA-1_B23WHTKLT4_1	527.2M	0.0M	0.0M	36.6M	2.7M	472.3M	236.2M	236.0M	236.2M	236.1M	273.8M	198.5M	470.8M	0.0M
659_dES-T1-TRNA-1_B23WHTKLT4_1	640.8M	0.0M	0.0M	46.1M	3.1M	572.2M	286.3M	286.0M	286.1M	286.1M	294.8M	277.4M	570.2M	0.0M
659_dc8-T1-TRNA-1_B23WHTKLT4_1	634.0M	0.0M	0.0M	42.9M	3.0M	569.3M	284.8M	284.5M	284.7M	284.6M	290.4M	278.9M	567.2M	0.0M
659_dcz-T1-TRNA-1_B23WHTKLT4_1	107.1M	0.0M	0.0M	10.8M	0.7M	91.5M	45.8M	45.7M	45.8M	45.7M	58.7M	32.8M	91.1M	0.0M
659_djb-T1-TRNA-1_B23WHTKLT4_1	635.7M	0.0M	0.0M	41.0M	3.0M	574.7M	287.5M	287.2M	287.4M	287.3M	286.3M	288.3M	572.5M	0.0M
659_dm4-T1-TRNA-1_B23WHTKLT4_1	227.7M	0.0M	0.0M	22.3M	1.3M	195.4M	97.8M	97.6M	97.7M	97.7M	124.6M	70.8M	194.6M	0.0M
659_dts-T1-TRNA-1_B23WHTKLT4_1	445.0M	0.0M	0.0M	31.5M	2.4M	397.6M	198.9M	198.7M	198.8M	198.8M	214.6M	183.0M	396.1M	0.0M
659_ecd-T1-TRNA-1_B23WHTKLT4_1	631.0M	0.0M	0.0M	36.6M	2.5M	576.0M	288.1M	287.9M	288.0M	288.0M	278.9M	297.1M	574.0M	0.0M
659_epP-T1-TRNA-1_B23WHTKLT4_1	649.2M	0.0M	0.0M	56.1M	3.3M	566.2M	283.3M	283.0M	283.2M	283.1M	302.4M	263.8M	564.3M	0.0M
659_ezg-T1-TRNA-1_B23WHTKLT4_1	638.6M	0.0M	0.0M	44.4M	3.1M	573.1M	286.7M	286.4M	286.6M	286.5M	285.0M	288.1M	571.0M	0.0M
659_gK-T1-TRNA-1_B23WHTKLT4_1	401.7M	0.0M	0.0M	29.9M	1.8M	355.9M	178.0M	177.9M	177.9M	177.9M	182.1M	173.7M	354.8M	0.0M
659_rd-T1-TRNA-1_B23WHTKLT4_1	624.7M	0.0M	0.0M	30.4M	2.7M	578.5M	289.4M	289.1M	289.3M	289.2M	282.1M	296.5M	576.2M	0.0M
FFPE_HD789_01_RNA_13_B23WHTKLT4_1	629.2M	0.0M	0.0M	35.0M	2.7M	575.8M	288.0M	287.8M	287.9M	287.9M	259.9M	315.9M	574.3M	0.0M
FFPE_V4_0002_RNA_0001_B23WHTKLT4_1	637.4M	0.0M	0.0M	43.4M	3.7M	571.8M	286.0M	285.7M	285.9M	285.9M	282.2M	289.6M	570.0M	0.0M
NTC_0001_0001_B23WHTKLT4_1	0.2M	0.0M	0.0M	0.2M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
tih_rna_sample_00087_B23WHTKLT4_1	638.1M	0.0M	0.0M	43.3M	2.9M	572.8M	286.5M	286.3M	286.4M	286.4M	287.6M	285.2M	571.0M	0.0M
tih_rna_sample_00087_B23WHTKLT4_2	639.2M	0.0M	0.0M	44.8M	3.0M	571.5M	285.9M	285.6M	285.8M	285.7M	293.9M	277.6M	569.7M	0.0M
tih_rna_sample_00089_B23WHTKLT4_1	399.7M	0.0M	0.0M	28.7M	1.6M	357.9M	179.0M	178.9M	179.0M	178.9M	176.7M	181.2M	356.7M	0.0M
tih_rna_sample_00089_B23WHTKLT4_2	640.3M	0.0M	0.0M	46.3M	2.7M	572.8M	286.5M	286.2M	286.4M	286.4M	283.0M	289.8M	571.0M	0.0M
tih_rna_sample_00090_B23WHTKLT4_1	472.0M	0.0M	0.0M	52.3M	2.8M	397.3M	198.8M	198.5M	198.7M	198.6M	228.6M	168.7M	395.8M	0.0M
tih_rna_sample_00090_B23WHTKLT4_2	660.9M	0.0M	0.0M	69.3M	3.9M	560.6M	280.5M	280.1M	280.4M	280.3M	315.6M	245.0M	558.5M	0.0M
tih_rna_sample_00096_B23WHTKLT4_1	631.9M	0.0M	0.0M	38.0M	2.8M	574.9M	287.6M	287.3M	287.5M	287.4M	299.3M	275.6M	573.1M	0.0M
tih_rna_sample_00096_B23WHTKLT4_2	631.6M	0.0M	0.0M	37.7M	2.9M	574.7M	287.5M	287.2M	287.4M	287.3M	300.5M	274.2M	572.9M	0.0M
tih_rna_sample_00097_B23WHTKLT4_1	641.3M	0.0M	0.0M	46.5M	2.6M	572.5M	286.4M	286.1M	286.3M	286.2M	278.1M	294.5M	570.5M	0.0M
tih_rna_sample_00097_B23WHTKLT4_2	641.1M	0.0M	0.0M	47.7M	2.6M	570.2M	285.2M	284.9M	285.2M	285.0M	282.9M	287.2M	568.0M	0.0M
tih_rna_sample_00116_B23WHTKLT4_1	636.7M	0.0M	0.0M	42.0M	3.4M	573.7M	287.0M	286.7M	286.9M	286.8M	307.1M	266.6M	571.3M	0.0M
tih_rna_sample_00116_B23WHTKLT4_2	602.0M	0.0M	0.0M	40.1M	3.2M	541.6M	270.9M	270.7M	270.9M	270.8M	292.5M	249.1M	539.3M	0.0M
tih_rna_sample_00121_B23WHTKLT4_1	632.7M	0.0M	0.0M	38.7M	2.9M	574.3M	287.3M	287.0M	287.2M	287.1M	304.7M	269.6M	572.3M	0.0M
tih_rna_sample_00121_B23WHTKLT4_2	632.7M	0.0M	0.0M	38.0M	3.0M	575.2M	287.8M	287.4M	287.7M	287.6M	300.9M	274.3M	573.2M	0.0M
tih_rna_sample_00124_B23WHTKLT4_1	489.0M	0.0M	0.0M	27.9M	2.6M	446.0M	223.1M	222.9M	223.1M	223.0M	226.8M	219.2M	444.4M	0.0M
tih_rna_sample_00124_B23WHTKLT4_2	477.9M	0.0M	0.0M	25.9M	2.6M	437.6M	218.9M	218.7M	218.9M	218.8M	216.6M	221.1M	436.0M	0.0M
tih_rna_sample_00136_B23WHTKLT4_1	564.3M	0.0M	0.0M	37.7M	2.7M	507.4M	253.9M	253.6M	253.7M	253.7M	274.9M	232.5M	505.8M	0.0M
tih_rna_sample_00136_B23WHTKLT4_2	573.6M	0.0M	0.0M	39.7M	2.7M	514.0M	257.2M	256.9M	257.0M	257.0M	282.9M	231.1M	512.4M	0.0M
tih_rna_sample_00145_B23WHTKLT4_1	638.8M	0.0M	0.0M	44.3M	3.2M	572.7M	286.5M	286.2M	286.4M	286.3M	286.9M	285.8M	570.2M	0.0M
tih_rna_sample_00145_B23WHTKLT4_2	633.0M	0.0M	0.0M	47.2M	3.2M	562.8M	281.6M	281.3M	281.5M	281.3M	298.5M	264.4M	560.5M	0.0M
tih_rna_sample_00146_B23WHTKLT4_1	627.3M	0.0M	0.0M	33.2M	3.1M	576.4M	288.3M	288.1M	288.2M	288.1M	280.7M	295.7M	574.5M	0.0M
tih_rna_sample_00146_B23WHTKLT4_2	628.4M	0.0M	0.0M	34.0M	3.1M	576.4M	288.3M	288.1M	288.3M	288.2M	286.0M	290.4M	574.5M	0.0M
tih_rna_sample_00149_B23WHTKLT4_1	499.4M	0.0M	0.0M	31.5M	2.1M	452.1M	226.2M	225.9M	226.1M	226.0M	244.1M	208.0M	450.4M	0.0M
tih_rna_sample_00149_B23WHTKLT4_2	539.5M	0.0M	0.0M	34.4M	2.3M	488.0M	244.1M	243.9M	244.0M	244.0M	262.4M	225.7M	486.2M	0.0M
tih_rna_sample_00150_B23WHTKLT4_1	526.0M	0.0M	0.0M	28.6M	2.2M	482.7M	241.4M	241.2M	241.3M	241.3M	238.9M	243.7M	480.9M	0.0M
tih_rna_sample_00150_B23WHTKLT4_2	629.4M	0.0M	0.0M	35.0M	2.7M	576.8M	288.5M	288.3M	288.4M	288.4M	284.1M	292.8M	574.8M	0.0M
tih_rna_sample_00158_B23WHTKLT4_1	484.3M	0.0M	0.0M	39.7M	2.6M	425.0M	212.6M	212.4M	212.5M	212.5M	223.8M	201.1M	423.6M	0.0M
tih_rna_sample_00158_B23WHTKLT4_2	350.6M	0.0M	0.0M	29.6M	1.9M	306.4M	153.2M	153.1M	153.2M	153.2M	164.3M	142.0M	305.4M	0.0M
tih_rna_sample_00161_B23WHTKLT4_1	626.6M	0.0M	0.0M	44.6M	2.7M	561.9M	281.1M	280.8M	281.0M	280.9M	294.5M	267.5M	559.9M	0.0M
tih_rna_sample_00161_B23WHTKLT4_2	639.5M	0.0M	0.0M	45.3M	2.8M	573.8M	287.1M	286.7M	287.0M	286.8M	295.3M	278.5M	571.8M	0.0M
tih_rna_sample_00163_B23WHTKLT4_1	398.5M	0.0M	0.0M	24.4M	1.7M	361.9M	181.0M	180.9M	181.0M	180.9M	181.1M	180.8M	360.8M	0.0M
tih_rna_sample_00163_B23WHTKLT4_2	632.3M	0.0M	0.0M	39.8M	2.8M	572.3M	286.3M	286.0M	286.2M	286.1M	292.2M	280.1M	570.5M	0.0M
tih_rna_sample_00164_B23WHTKLT4_1	541.0M	0.0M	0.0M	44.1M	3.4M	476.8M	238.5M	238.3M	238.4M	238.4M	256.1M	220.7M	475.1M	0.0M
tih_rna_sample_00164_B23WHTKLT4_2	300.6M	0.0M	0.0M	30.5M	2.1M	257.9M	129.0M	128.9M	129.0M	128.9M	140.9M	117.0M	256.8M	0.0M
tih_rna_sample_00166_B23WHTKLT4_1	630.3M	0.0M	0.0M	37.3M	2.7M	573.1M	286.7M	286.4M	286.6M	286.5M	289.2M	283.8M	571.1M	0.0M
tih_rna_sample_00166_B23WHTKLT4_2	489.9M	0.0M	0.0M	29.6M	2.1M	444.7M	222.5M	222.2M	222.4M	222.3M	227.6M	217.1M	443.2M	0.0M
tih_rna_sample_00434_B23WHTKLT4_1	635.8M	0.0M	0.0M	42.1M	2.6M	571.8M	286.0M	285.8M	285.9M	285.9M	308.0M	263.8M	569.9M	0.0M
tih_rna_sample_00434_B23WHTKLT4_2	634.6M	0.0M	0.0M	40.2M	2.6M	573.0M	286.7M	286.4M	286.5M	286.5M	298.9M	274.2M	570.9M	0.0M
tih_rna_sample_00451_B23WHTKLT4_1	618.5M	0.0M	0.0M	42.4M	3.1M	554.7M	277.5M	277.2M	277.4M	277.3M	298.6M	256.1M	552.5M	0.0M
tih_rna_sample_00451_B23WHTKLT4_2	373.0M	0.0M	0.0M	26.3M	2.0M	333.5M	166.8M	166.7M	166.8M	166.7M	181.4M	152.1M	332.2M	0.0M
tih_rna_sample_00457_B23WHTKLT4_1	628.6M	0.0M	0.0M	35.0M	2.9M	575.5M	287.9M	287.7M	287.8M	287.7M	284.2M	291.3M	573.6M	0.0M
tih_rna_sample_00457_B23WHTKLT4_2	630.9M	0.0M	0.0M	36.6M	3.0M	575.8M	288.0M	287.8M	288.0M	287.9M	285.9M	289.9M	573.8M	0.0M
tih_rna_sample_00461_B23WHTKLT4_1	109.1M	0.0M	0.0M	7.5M	0.4M	98.0M	49.0M	49.0M	49.0M	49.0M	48.8M	49.2M	97.7M	0.0M
tih_rna_sample_00461_B23WHTKLT4_2	415.8M	0.0M	0.0M	30.0M	1.7M	371.5M	185.9M	185.7M	185.8M	185.7M	189.9M	181.7M	370.3M	0.0M
tih_rna_sample_00462_B23WHTKLT4_1	623.3M	0.0M	0.0M	29.7M	2.6M	577.5M	288.9M	288.6M	288.8M	288.7M	278.1M	299.5M	575.6M	0.0M
tih_rna_sample_00462_B23WHTKLT4_2	623.8M	0.0M	0.0M	29.4M	2.6M	578.6M	289.4M	289.2M	289.3M	289.2M	273.8M	304.8M	576.6M	0.0M
tih_rna_sample_00464_B23WHTKLT4_1	588.4M	0.0M	0.0M	37.1M	3.0M	532.0M	266.1M	265.9M	266.0M	266.0M	276.4M	255.6M	530.1M	0.0M
tih_rna_sample_00464_B23WHTKLT4_2	434.2M	0.0M	0.0M	29.5M	2.2M	389.6M	194.9M	194.7M	194.8M	194.8M	210.0M	179.6M	388.2M	0.0M
tih_rna_sample_00467_B23WHTKLT4_1	647.2M	0.0M	0.0M	65.7M	4.0M	553.0M	276.7M	276.3M	276.6M	276.5M	319.2M	233.8M	551.0M	0.0M
tih_rna_sample_00467_B23WHTKLT4_2	665.0M	0.0M	0.0M	71.9M	4.0M	562.3M	281.4M	280.9M	281.2M	281.1M	336.6M	225.7M	560.3M	0.0M
tih_rna_sample_00473_B23WHTKLT4_1	630.4M	0.0M	0.0M	37.6M	2.6M	573.6M	286.9M	286.7M	286.8M	286.7M	279.3M	294.3M	571.8M	0.0M
tih_rna_sample_00473_B23WHTKLT4_2	629.9M	0.0M	0.0M	36.3M	2.6M	575.0M	287.6M	287.3M	287.5M	287.4M	274.6M	300.4M	573.1M	0.0M
tih_rna_sample_00479_B23WHTKLT4_1	632.5M	0.0M	0.0M	38.3M	2.5M	574.9M	287.6M	287.3M	287.5M	287.4M	266.5M	308.4M	572.8M	0.0M
tih_rna_sample_00479_B23WHTKLT4_2	403.4M	0.0M	0.0M	25.8M	1.6M	364.7M	182.5M	182.3M	182.4M	182.3M	173.4M	191.4M	363.4M	0.0M
tih_rna_sample_00480_B23WHTKLT4_1	612.6M	0.0M	0.0M	44.6M	2.9M	547.6M	274.0M	273.7M	273.8M	273.8M	287.4M	260.2M	546.0M	0.0M
tih_rna_sample_00480_B23WHTKLT4_2	639.0M	0.0M	0.0M	46.1M	3.1M	571.6M	286.0M	285.6M	285.8M	285.8M	300.1M	271.5M	569.9M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	208168245	0.1947%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	7901	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	6274	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	3	2337	0.0000%
CATTGTGGTAATTGGCATGCTGGCCACGGGCCTCAGTCCCACCACCCGTA	2	75	0.0000%
ATGGGAATCCATTGGCGCTTCGGACAAGTCCTTCCCCTGCTCCGCCTTGA	2	70	0.0000%
AAAGTAATAGCTACTATTTTTTCTCTTTCAGTTGCAGGAGAAATAACAAG	2	72	0.0000%
GACATGAAGGTGCAGAGGGAGACAGATGAGGTGAAATAGAAGGTCATGCT	2	74	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	3636	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCACTTCGTATCTAGT	1	434206	0.0004%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGACGGCAAATCTGGG	1	437996	0.0004%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGACGGCAAATCTAGG	1	105132	0.0001%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGATGTCCAATCTGGG	1	423835	0.0004%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGATGTCCAATCTAGG	1	128747	0.0001%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTAGCTGCGATCTGGG	1	423898	0.0004%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTACTTCGTGATCTGGG	1	443690	0.0004%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTAACCTCAAATCTGGG	1	499330	0.0005%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTAACCTCAAATCTAGG	1	202349	0.0002%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGAAGACCTAATCTGGG	1	367215	0.0003%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGAAGACCTAATCTGGT	1	77747	0.0001%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	81940393	0.1669%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	3918	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	3134	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	1439	0.0000%
CATTGTGGTAATTGGCATGCTGGCCACGGGCCTCAGTCCCACCACCCGTA	2	75	0.0000%
ATGGGAATCCATTGGCGCTTCGGACAAGTCCTTCCCCTGCTCCGCCTTGA	2	70	0.0000%
AAAGTAATAGCTACTATTTTTTCTCTTTCAGTTGCAGGAGAAATAACAAG	2	72	0.0000%
GACATGAAGGTGCAGAGGGAGACAGATGAGGTGAAATAGAAGGTCATGCT	2	74	0.0000%
GCTGCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	1	777	0.0000%
GCTGCCGAGTGTTACAGCCCCCCCGGCAGC	1	174	0.0000%
GCTGCTGCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	1	88	0.0000%
CTTCGCGCCCTCTCTCTCTCTCTCTCCCCC	1	56	0.0000%
TCTGGCTGCCGACAGTCAGGTTCTGCTGCAGAAGCACGTTCTCTATGCAG	1	49	0.0000%
GCGGGGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	1	45	0.0000%
CTGCCATTGCAGGTTTGGATATCCTTCTGCCAGCAAAACCCAGCATGAAC	1	41	0.0000%
GCGGGGGAGAGAGAGAGAGAGAGGGCGC	1	41	0.0000%
CCCCGTCCTCCCCCCTCCCCGGGG	1	37	0.0000%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	1	36	0.0000%
GGCATGTACTTGCCCCGCGCTGTGCTCGTGGATCTGGAGCTGGGCGCCAT	1	36	0.0000%
GGCAGCCGCAGGGGCTTCAGCACCACCTCGGCCATCACCCCGGCAGCTGG	1	35	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0020/B23WHTKLT4/nfcore_rnafusion__3e501777--20260520-120107' --project-dir /mnt/efs/dev_env/smedina/code/Nextflow/rnafusion -profile docker,eks,std_run -resume 22acd240-6c95-4df1-99a0-53c8f7daf161 -name dev_rna_exp0020-3e501777 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0042_B23WHTKLT4/' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0042_B23WHTKLT4/bclconvert_samplesheet.csv' --flowcell_id 20260515_LH00995_0042_B23WHTKLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0020/B23WHTKLT4/nfcore_rnafusion__3e501777--20260520-120107'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0020-3e501777
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0020/B23WHTKLT4/nfcore_rnafusion__3e501777--20260520-120107
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0042_B23WHTKLT4/
flowcell_id: 20260515_LH00995_0042_B23WHTKLT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260515_LH00995_0042_B23WHTKLT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
arriba_gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir//ref_annot.gtf
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks