Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 839474
total bases: 126760574
Q20 bases: 110576327(87.2324%)
Q30 bases: 86561368(68.2873%)

Read2 before filtering:
total reads: 839474
total bases: 126760574
Q20 bases: 122305259(96.4853%)
Q30 bases: 103772510(81.865%)

Read1 after filtering:
total reads: 26975
total bases: 2853966
Q20 bases: 2705348(94.7926%)
Q30 bases: 2468152(86.4815%)

Read2 after filtering:
total reads: 26975
total bases: 2879362
Q20 bases: 2813116(97.6993%)
Q30 bases: 2642110(91.7603%)

Filtering result:
reads passed filter: 53950
reads failed due to low quality: 34080
reads failed due to too many N: 0
reads failed due to too short: 1590918
reads with adapter trimmed: 849756
bases trimmed due to adapters: 121426679

Duplication rate: 67.3407%

Insert size peak (evaluated by paired-end reads): 36

JSON report: NTC_0001_0001_B23WHTKLT4_1.fastp.json
HTML report: NTC_0001_0001_B23WHTKLT4_1.fastp.html

fastp --in1 NTC_0001_0001_B23WHTKLT4_1_1.fastq.gz --in2 NTC_0001_0001_B23WHTKLT4_1_2.fastq.gz --out1 NTC_0001_0001_B23WHTKLT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_B23WHTKLT4_1_2.fastp.fastq.gz --json NTC_0001_0001_B23WHTKLT4_1.fastp.json --html NTC_0001_0001_B23WHTKLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 4 seconds