Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 49174747
total bases: 7425386797
Q20 bases: 7213207608(97.1425%)
Q30 bases: 6902300091(92.9554%)

Read2 before filtering:
total reads: 49174747
total bases: 7425386797
Q20 bases: 7239853216(97.5014%)
Q30 bases: 6861129068(92.401%)

Read1 after filtering:
total reads: 47921027
total bases: 5482315550
Q20 bases: 5458717254(99.5696%)
Q30 bases: 5350381544(97.5935%)

Read2 after filtering:
total reads: 47921027
total bases: 5489083167
Q20 bases: 5456492720(99.4063%)
Q30 bases: 5335926849(97.2098%)

Filtering result:
reads passed filter: 95842054
reads failed due to low quality: 1299330
reads failed due to too many N: 3350
reads failed due to too short: 1204760
reads with adapter trimmed: 79517988
bases trimmed due to adapters: 3548909292

Duplication rate: 53.0888%

Insert size peak (evaluated by paired-end reads): 107

JSON report: 659_dcz-T1-TRNA-1_B23WHTKLT4_1.fastp.json
HTML report: 659_dcz-T1-TRNA-1_B23WHTKLT4_1.fastp.html

fastp --in1 659_dcz-T1-TRNA-1_B23WHTKLT4_1_1.fastq.gz --in2 659_dcz-T1-TRNA-1_B23WHTKLT4_1_2.fastq.gz --out1 659_dcz-T1-TRNA-1_B23WHTKLT4_1_1.fastp.fastq.gz --out2 659_dcz-T1-TRNA-1_B23WHTKLT4_1_2.fastp.fastq.gz --json 659_dcz-T1-TRNA-1_B23WHTKLT4_1.fastp.json --html 659_dcz-T1-TRNA-1_B23WHTKLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 87 seconds