Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 52007000
total bases: 7853057000
Q20 bases: 7739077419(98.5486%)
Q30 bases: 7516447113(95.7136%)

Read2 before filtering:
total reads: 52007000
total bases: 7853057000
Q20 bases: 7699883349(98.0495%)
Q30 bases: 7391860632(94.1272%)

Read1 after filtering:
total reads: 50612085
total bases: 6680646061
Q20 bases: 6656266028(99.6351%)
Q30 bases: 6536802988(97.8469%)

Read2 after filtering:
total reads: 50612085
total bases: 6684916402
Q20 bases: 6641779559(99.3547%)
Q30 bases: 6482505680(96.9721%)

Filtering result:
reads passed filter: 101224170
reads failed due to low quality: 1647966
reads failed due to too many N: 3932
reads failed due to too short: 1137932
reads with adapter trimmed: 54360901
bases trimmed due to adapters: 1958248624

Duplication rate: 69.2225%

Insert size peak (evaluated by paired-end reads): 120

JSON report: tih_rna_sample_00461_B23WHTKLT4_1.fastp.json
HTML report: tih_rna_sample_00461_B23WHTKLT4_1.fastp.html

fastp --in1 tih_rna_sample_00461_B23WHTKLT4_1_1.fastq.gz --in2 tih_rna_sample_00461_B23WHTKLT4_1_2.fastq.gz --out1 tih_rna_sample_00461_B23WHTKLT4_1_1.fastp.fastq.gz --out2 tih_rna_sample_00461_B23WHTKLT4_1_2.fastp.fastq.gz --json tih_rna_sample_00461_B23WHTKLT4_1.fastp.json --html tih_rna_sample_00461_B23WHTKLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 99 seconds